The Human Cytomegalovirus Gene UL79 Is Required for the Accumulation of Late Viral Transcripts

Self Cite

In this study, we report that murine cytomegalovirus (MCMV) protein pM92 regulates viral late gene expression during virus infection. Previously, we have shown that MCMV protein pM79 and its human cytomegalovirus (HCMV) homologue pUL79 are required for late viral gene transcription. Identification of additional factors involved is critical to dissecting the mechanism of this regulation. We show here that pM92 accumulated abundantly at late times of infection in a DNA synthesis-dependent manner and localized to nuclear viral replication compartments. To investigate the role of pM92, we constructed a recombinant virus SMin92, in which pM92 expression was disrupted by an insertional/frameshift mutation. During infection, SMin92 accumulated representative viral immediate-early gene products, early gene products, and viral DNA sufficiently but had severe reduction in the accumulation of late gene products and was thus unable to produce infectious progeny. Coimmunoprecipitation and mass spectrometry analysis revealed an interaction between pM92 and pM79, as well as between their HCMV homologues pUL92 and pUL79. Importantly, we showed that the growth defect of pUL92-deficient HCMV could be rescued in trans by pM92. This study indicates that pM92 is an additional viral regulator of late gene expression, that these regulators (represented by pM92 and pM79) may need to complex with each other for their activity, and that pM92 and pUL92 share a conserved function in CMV infection. pM92 represents a potential new target for therapeutic intervention in CMV disease, and a gateway into studying a largely uncharted viral process that is critical to the viral life cycle.

Section: Discussionsupporting

confidence: 58%

Section: Pm92 Is Essential For MCMV Replication In Fibroblastsmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Murine Cytomegalovirus Protein pM92 Is a Conserved Regulator of Viral Late Gene Expression

Chapa

Perng

French

et al. 2014

Self Cite

“…The 50-bp sequences at the 5Ј end of these primers were homologous to the viral DNA sequences immediately upstream or downstream of the amino acid residue 239 of the UL38 ORF: 5Ј-GGAAAATT CCTATGACCTTCGTGGATCGCGACTCGCTGCGAGCCAATTCGTGAA CCACGTCGTGGAATGCCTTC-3Ј and 5Ј-TGCGCCGGGGCGTGAGAAG GCTGAGCCCCGGTGGCCTGGATGTGGGCCAAAAGGACGACGACGA CAAGTAA-3Ј. The cassette was recombined into the UL38 gene carried in pAD-GFP, and the kanamycin sequence was subsequently removed by Flp/FRT recombination as previously described (30). The final clone (pADtrunUL38 ) contained a stop codon along with a small FRT site inserted at the residue 240 of the UL38 ORF.…”

Section: Methodsmentioning

confidence: 99%

The Human Cytomegalovirus Protein pUL38 Suppresses Endoplasmic Reticulum Stress-Mediated Cell Death Independently of Its Ability To Induce mTORC1 Activation

Zhou

Xuan

Gualberto

et al. 2011

Self Cite

As obligate intracellular parasites, viruses not only hijack cellular machinery, they also deregulate host stress responses for their infection. Human cytomegalovirus (HCMV) modulates the endoplasmic reticulum (ER) stress response, due at least in part to the viral protein pUL38, and one of the consequences is to maintain the viability of infected cells. Consequently, pUL38-deficient virus induces premature cell death during infection. In addition, pUL38 activates mammalian target of rapamycin complex 1 (mTORC1), which may also antagonize other detrimental cellular stresses (N. J. Moorman et al., Cell Host Microbe 3:253-262, 2008). It remains elusive how pUL38 inhibition of cell death is related to mTORC1 activation. In this study, we defined the interplay of the two pUL38 activities. We constructed a series of pUL38 truncation mutants based on the secondary structure prediction and evolutionary conservation of its sequence. We found that the N-terminal 239 residues of pUL38 were necessary and sufficient to block cell death induced by pUL38-deficient virus or by the ER stress inducer tunicamycin. However, this pUL38 domain was unable to activate mTORC1 when expressed alone. Importantly, small-molecule inhibitors of mTORC1, rapamycin or torin 1, did not compromise pUL38 activity to block cell death in isolation or in virus infection. Expression of a constitutively active variant of an mTORC1 activator, Rheb (Ras homolog enriched in brain), could not prevent cell death induced by pUL38-deficient virus. Collectively, we provide genetic and biochemical evidence that pUL38 prevents ER stress-induced cell death independent of its role in mTORC1 activation.

“…Due to overlapping adjacent coding regions at the 5= ends of the UL48 and UL103 genes, the FKBP segment (28) was inserted at the 3= end of the target genes. Selective markers (GalK and kanamycin) flanked by FKBP and FRT sequences were PCR amplified from pYD-C630 (provided by Dong Yu, Washington University) (29). The primers for recombineering are listed in Table 2.…”

Section: Methodsmentioning

confidence: 99%

Identification of Human Cytomegalovirus Genes Important for Biogenesis of the Cytoplasmic Virion Assembly Complex

Das

Ortiz

Gurczynski

et al. 2014

Human cytomegalovirus (HCMV) has many effects on cells, including remodeling the cytoplasm to form the cytoplasmic virion assembly complex (cVAC), the site of final virion assembly. Viral tegument, envelope, and some nonstructural proteins localize to the cVAC, and cytoskeletal filaments radiate from a microtubule organizing center in the cVAC. The endoplasmic reticulum (ER)-to-Golgi intermediate compartment, Golgi apparatus, and trans-Golgi network form a ring that outlines the cVAC. The center of the cVAC ring is occupied by numerous vesicles that share properties with recycling endosomes. In prior studies, we described the three-dimensional structure and the extensive remodeling of the cytoplasm and shifts in organelle identity that occur during development of the cVAC. The objective of this work was to identify HCMV proteins that regulate cVAC biogenesis. Because the cVAC does not form in the absence of viral DNA synthesis, we employed HCMV-infected cells transfected with synthetic small interfering RNAs (siRNAs) that targeted 26 candidate early-late and late protein-coding genes required for efficient virus replication. We identified three HCMV genes (UL48, UL94, and UL103) whose silencing had major effects on cVAC development, including failure to form the Golgi ring and dispersal of markers of early and recycling endosomes. To confirm and extend the siRNA results, we constructed recombinant viruses in which pUL48 and pUL103 are fused with a regulatable protein destabilization domain (dd-FKBP). In the presence of a stabilizing ligand (Shield-1), the cVAC appeared to develop normally. In its absence, cVAC development was abrogated, verifying roles for pUL48 and pUL103 in cVAC biogenesis. IMPORTANCE Human cytomegalovirus (HCMV) is an important human pathogen that causes disease and disability in immunocompromised individuals and in children infected before birth. Few drugs are available for treatment of HCMV infections. HCMV remodels the interior of infected cells to build a factory for assembling new infectious particles (virions), the cytoplasmic virion assembly complex (cVAC). Here, we identified three HCMV genes (UL48, UL94, and UL103) as important contributors to cVAC development. In addition, we found that mutant viruses that express an unstable form of the UL103 protein have defects in cVAC development and production of infectious virions and produce small plaques and intracellular virions with aberrant appearances. Of these, only the reduced production of infectious virions is not eliminated by chemically stabilizing the protein. In addition to identifying new functions for these HCMV genes, this work is a necessary prelude to developing novel antivirals that would block cVAC development.