The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia

Alwadai, Aisha Saleh; Perveen, Kahkashan; Alwahibi, Mona S.

doi:10.3390/molecules27082525

Cited by 18 publications

(8 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Compared with no straw return, FM decreased the relative abundance of Trichoderma , while SM increased it. Trichoderma is antagonistic to many plant-pathogenic fungi and can promote plant growth and crop yield (Alwadai et al, 2022 ). These results indicate that long-term straw return accelerates the conversion of soil organic matter, which affects the contents of harmful and beneficial microorganisms in the soils, thus changing the soil microbial community structure.…”

Section: Discussionmentioning

confidence: 99%

Effect of different straw retention techniques on soil microbial community structure in wheat–maize rotation system

Zhang

Cui

et al. 2023

Front. Microbiol.

View full text Add to dashboard Cite

Rotational straw return technique is considered an effective measure for improving soil quality and maintaining soil microorganisms. However, there are few reports on the influence of wheat–maize crop rotation and straw-returning tillage on crop soil microbial communities in China. This study aimed to investigate how wheat or maize straw-incorporation practices affect bacterial and fungal communities under wheat–maize rotational farming practices. To clarify the effects of straw incorporation on microbial composition, microbial communities from soils subjected to different treatments were identified using high-throughput sequencing. Our results showed that, before corn planting, wheat and maize straw returning reduced bacterial density and increased their diversity but had no effect on fungal diversity. However, before wheat planting, returning wheat and corn stalks to the field increased the diversity of soil bacteria and fungi, whereas returning corn stalks to the field reduced the diversity of fungi and other microorganisms. Straw return significantly increased the relative abundance of Ascomycota in the first season and decreased it in the second season; however, in the second season, wheat straw return increased the relative abundance of Bradyrhizobium, which can promote the soil microbial nitrogen cycle and provide nitrogen to the soil. Wheat and maize straw return increased the relative abundance of Chaetomium, whereas, individually, they decreased the relative abundance. In addition, we detected two fungal pathogens (Fusarium and Trichoderma) under the two planting patterns and found that the relative abundance of pathogenic Fusarium increased with wheat straw return (FW and SW). Trichoderma increased after treatment with maize straw return before wheat planting (S group). These results suggest that wheat straw return (FW and SW) and maize straw return might have a negative impact on the pathogenic risk. Therefore, further studies are needed to determine how to manage straw returns in agricultural production.

show abstract

Section: Discussionmentioning

confidence: 99%

Effect of different straw retention techniques on soil microbial community structure in wheat–maize rotation system

Zhang

Cui

et al. 2023

Front. Microbiol.

View full text Add to dashboard Cite

show abstract

“…that can contribute to the management of Fusarium oxysporum . Recently, Alwadai et al isolated 48 Trichoderma strains from soil samples of the Abha region that showed significant biocontrol efficacy against Fusarium oxysporum and Helminthosporium rostratum [ 48 ]. Chen et al reported T. harzianum ZC51 could inhibit the pathogenic F. oxysporum and induce the expression of R. pseudostellariae defense genes [ 49 ].…”

Section: Discussionmentioning

confidence: 99%

A Salt-Tolerant Strain of Trichoderma longibrachiatum HL167 Is Effective in Alleviating Salt Stress, Promoting Plant Growth, and Managing Fusarium Wilt Disease in Cowpea

Liu

Pang

et al. 2023

JoF

View full text Add to dashboard Cite

Salt stress is a constraint factor in agricultural production and restricts crops yield and quality. In this study, a salt-tolerant strain of Trichoderma longibrachiatum HL167 was obtained from 64 isolates showing significant salt tolerance and antagonistic activity to Fusarium oxysporum. T. longibrachiatum HL167 inhibited F. oxysporum at a rate of 68.08% in 200 mM NaCl, penetrated F. oxysporum under 200 mM NaCl, and eventually induced F. oxysporum hyphae breaking, according to electron microscope observations. In the pot experiment, pretreatment of cowpea seedlings with T. longibrachiatum HL167 reduced the accumulation level of ROS in tissues and the damage caused by salt stress. Furthermore, in the field experiment, it was discovered that treating cowpea with T. longibrachiatum HL167 before root inoculation with F. oxysporum can successfully prevent and control the development of cowpea Fusarium wilt, with the best control effect reaching 61.54%. Moreover, the application of HL 167 also improved the K+/Na+ ratio of cowpea, alleviated the ion toxicity of salt stress on cowpea, and HL167 was found to effectively colonize the cowpea roots. T. longibrachiatum HL167, which normally survives in saline–alkali environments and has the functions of disease prevention and plant growth promotion capabilities, has important research implications for improving the saline–alkali soil environment and for the sustainable development of green agriculture.

show abstract

“…All PDA plates were incubated at 25 °C for 3 d. A single Trichoderma colony was inoculated onto a new PDA plate and incubated at 25 °C for 3 d. In total, 15 Trichoderma strains with different colony morphological characters were obtained. The internal transcribed spacer (ITS) region of each strain was amplified using the universal primers ITS4 (5ʹ‐TCCTCCGCTTATTGATATGC‐3ʹ) and ITS5 (5ʹ‐GGAAGTAAAAGTCGTAACAAGG‐3ʹ) (Gu et al ., 2020; Alwadai et al ., 2022), which was then sequenced and aligned against sequences of the type strain of Trichoderma species from the US National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov). The Molecular Evolutionary Genetics Analysis (MEGA 11) program was used to build a phylogenetic tree using the neighbor‐joining method with a bootstrap value of 1000 replicates.…”

Section: Methodsmentioning

confidence: 99%

Trichoderma metabolites trigger aggregation behavior in Formosan subterranean termites (Coptotermes formosanus)

Zhang

et al. 2023

Insect Science

View full text Add to dashboard Cite

Our previous studies have shown that some Trichoderma fungi trigger aggregation behavior in Formosan subterranean termites, Coptotermes formosanus Shiraki. However, the mechanisms underlying the induction of termite aggregation by Trichoderma fungi remain unclear. Here, we found that the aqueous or acetone extract of Trichoderma asperellum Samuels, Lieckfeldt & Nirenberg and Trichoderma virens Pers. ex Fries isolated from the gut or cuticle of C. formosanus elicited significant termite aggregation in 2‐choice tests. We then screened 9 Trichoderma metabolites (3‐acetoxy‐2‐butanone, phenol, 3‐ethoxypropionic acid, ethyl 2,4‐dioxovalerate, diglycolic acid, d‐valine, styrene, 3‐aminopyridine, and hexyl acetoacetate) that triggered termite aggregation. Among them, phenol (1 000 μg/mL), 3‐ethoxypropionic acid (10 μg/mL), ethyl 2,4‐dioxovalerate (1 000 μg/mL), and diglycolic acid (1 000 μg/mL) showed the strongest activities, triggering termite aggregation throughout the 24‐h period. As T. asperellum and T. virens produce different metabolites that trigger aggregation behavior in termites, the mechanisms underlying the interaction between subterranean termites and Trichoderma fungi likely vary. Future studies are needed to test whether these chemicals can attract termites and increase bait consumption.

show abstract

The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia

Cited by 18 publications

References 37 publications

Effect of different straw retention techniques on soil microbial community structure in wheat–maize rotation system

Effect of different straw retention techniques on soil microbial community structure in wheat–maize rotation system

A Salt-Tolerant Strain of Trichoderma longibrachiatum HL167 Is Effective in Alleviating Salt Stress, Promoting Plant Growth, and Managing Fusarium Wilt Disease in Cowpea

Trichoderma metabolites trigger aggregation behavior in Formosan subterranean termites (Coptotermes formosanus)

Contact Info

Product

Resources

About