The metalloendopeptidase nardilysin (NRDc) is potently inhibited by heparin-binding epidermal growth factor-like growth factor (HB-EGF)

Abstract

Nardilysin (N-arginine dibasic convertase, or NRDc) is a cytosolic and cell-surface metalloendopeptidase that, in vitro, cleaves substrates upstream of Arg or Lys in basic pairs. NRDc differs from most of the other members of the M16 family of metalloendopeptidases by a 90 amino acid acidic domain (DAC) inserted close to its active site. At the cell surface, NRDc binds heparin-binding epidermal growth factor-like growth factor (HB-EGF) and enhances HB-EGF-induced cell migration. An active-site mutant of NRDc fulfills this function as well as wild-type NRDc, indicating that the enzyme activity is not required for this process. We now demonstrate that NRDc starts at Met(49). Furthermore, we show that HB-EGF not only binds to NRDc but also potently inhibits its enzymic activity. NRDc-HB-EGF interaction involves the 21 amino acid heparin-binding domain (P21) of the growth factor, the DAC of NRDc and most probably its active site. Only disulphide-bonded P21 dimers are inhibitory. We also show that Ca(2+), via the DAC, regulates both NRDc activity and HB-EGF binding. We conclude that the DAC is thus a key regulatory element for the two distinct functions that NRDc fulfills, i.e. as an HB-EGF modulator and a peptidase.

Nardilysin Enhances Ectodomain Shedding of Heparin-binding Epidermal Growth Factor-like Growth Factor through Activation of Tumor Necrosis Factor-α-converting Enzyme

“…However, the precise mechanism by which the formation of the complex is enhanced has not been clarified. NRDc is a cytosolic enzyme with no signal peptide; however, it is exported out of the cell by unknown mechanisms (27)(28)(29). The translocation of NRDc from the cytosol to the cell surface might nicely explain how the formation of a complex with TACE is enhanced by PMA without any significant change in the total expression level of the protein.…”

“…Expression of the enzyme is widespread and especially high in testis, heart, and skeletal muscle (26). NRDc is expressed mainly in the cytoplasm, but interestingly, it is also exported out of cells and distributed on the cell surface, although it has no apparent signal peptide sequence (27)(28)(29). While examining the biological significance of the binding of NRDc to pro-HB-EGF, we found that NRDc enhances ectodomain shedding of the growth factor.…”

“…Although NRDc is found in conditioned media, it is found primarily in the cytosol and on the cell surface (27,29). Thus, we examined the effect of coexpression of NRDc and AP-HB-EGF on HB-EGF shedding.…”

“…4D). NRDc is expressed primarily in the cytoplasm, but it is also found on the cell surface (27)(28)(29). Immunocytochemistry of transfected cells suggested that FIGURE 5.…”

Deletion of the Gene Encoding Proprotein Convertase 5/6 Causes Early Embryonic Lethality in the Mouse

“…Deletion of the sequence corresponding to exon 4 in a pIRES2-enhanced green fluorescent protein (EGFP) recombinant vector containing a mouse PC5A cDNA (pIR-mPC5A-V5) was achieved by a two-step PCR (15). Two sense and antisense primers reconstituting the exon 3-to-exon 5 junction (5Ј-GTATGTGGTACATGGATGCTCTGGCAAGTTGCG and 5Ј-GCA ACTTGCCAGAGCATCCATGTACCACATACTTGGCC) and two distal primers, located upstream of a unique EcoRI site in the polylinker (sense, 5Ј-CGGACT CAGATCTCGAGC) and downstream of a unique BsmBI in the mPC5A sequence (antisense, 5Ј-CACATCGCAACTTGCCATGTACCACATACTTGGCC), led to the final amplification of a 1,180-bp fragment that was subcloned in a pDRIVE vector (QIAGEN, Mississauga, Ontario, Canada).…”