The MicroRNA156 system: A tool in plant biotechnology

Aung, Banyar; Gruber, Margaret Y.; Hannoufa, Abdelali

doi:10.1016/j.bcab.2015.08.002

Cited by 31 publications

(26 citation statements)

References 135 publications

(237 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…miR156 has been contemplated as a molecular tool to improve traits of interest in various plant species (Aung et al ). Our previous research showed that miR156 increases forage yield, delays flowering and improves drought and salinity responses in alfalfa (Arshad et al , ).…”

Section: Discussionmentioning

confidence: 99%

“…Nonetheless, more studies are needed to further dissect the role of miR156/SPL13 network in plant response not only to heat but also to other stresses. The miR156 system is especially useful in enhancing the vegetative yield of forage crops and leafy vegetables (Aung et al ) due to the conserved effects on flowering time and fruit development; however, the identification of downstream genes affecting heat stress tolerance more specifically would allow this system to be more widely applicable to the development of crop varieties that are tolerant to abiotic stress.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Alfalfa response to heat stress is modulated by microRNA156

Matthews

Arshad

Hannoufa

2018

Physiologia Plantarum

Self Cite

View full text Add to dashboard Cite

Heat stress and extreme temperatures negatively affect plant development by disrupting regular cellular and biochemical functions, ultimately leading to reduced crop production. Alfalfa (Medicago sativa) is an important forage crop grown worldwide as forage for livestock feed. Limiting the effects of abiotic stress by developing alfalfa cultivars that are stress tolerant would help mitigate losses to crop production. Members of the microRNA156 (miR156) family regulate the Squamosa Promoter-Binding Protein-Like (SPL) genes that in turn impact plant growth and development by regulating downstream genes in response to various abiotic stresses. In this study, alfalfa with miR156 overexpression and SPL13 RNAi knockdown show increased tolerance to heat stress (40°C). Transgenic plants show high water potential and increased non-enzymatic antioxidant content under heat stress. Moreover, anthocyanin content and chlorophyll abundance were increased under stress. Expression of some important transcription factors and downstream genes involved in abiotic stress response were altered in miR156-overexpressing genotypes under heat. Taken together, our results demonstrate that the miR156/SPL13 network contributes to improving heat stress tolerance in alfalfa.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Alfalfa response to heat stress is modulated by microRNA156

Matthews

Arshad

Hannoufa

2018

Physiologia Plantarum

Self Cite

View full text Add to dashboard Cite

show abstract

“…TB1 is a negative regulator of branching and plays an important role in branching regulation by light and other signals, such as plant hormones [ 81 ]. One of the common phenotypes of miR156 overexpression plants is enhanced branching, which gives a bushy appearance [ 22 , 82 ]. Like flowering control, branching is also an SPL-mediated stimulus.…”

Section: Micrornas In Plant Developmentmentioning

confidence: 99%

“…A previous finding showed that miR156 load changes are mainly attributed to the sensitive MiR156 genes [ 21 ]. The genome analysis shows that the miR156 regulatory range is highly conserved during plant evolution [ 22 ]. Research on plant structure has been carried out in various species, including Arabidopsis , rice, and other plants.…”

Section: Introductionmentioning

confidence: 99%

Characterizing the Role of the miR156-SPL Network in Plant Development and Stress Response

Jeyakumar

Ali

Wang

et al. 2020

Plants

View full text Add to dashboard Cite

MicroRNA (miRNA) is a short, single-stranded, non-coding RNA found in eukaryotic cells that can regulate the expression of many genes at the post-transcriptional level. Among various plant miRNAs with diverse functions, miR156 plays a key role in biological processes, including developmental regulation, immune response, metabolic regulation, and abiotic stress. MiRNAs have become the regulatory center for plant growth and development. MicroRNA156 (miR156) is a highly conserved and emerging tool for the improvement of plant traits, including crop productivity and stress tolerance. Fine-tuning of squamosa promoter biding-like (SPL) gene expression might be a useful strategy for crop improvement. Here, we studied the regulation of the miR156 module and its interaction with SPL factors to understand the developmental transition of various plant species. Furthermore, this review provides a strong background for plant biotechnology and is an important source of information for further molecular breeding to optimize farming productivity.

show abstract

“…We found Spar-miR156e (UGACAGAAGAGAGUGAGCACA) up-regulated in both taxa, and Spar-miR398 (UGUGUUCUCAGGUCGCCCCCG), up-regulated in Spartina leaves but down-regulated in wheat roots. MIR 156 and MIR 398 families are shared among spermaphytes, and their impact in stress responses are also well described (Ding et al ., 2010; Aung et al ., 2015). In Spartina , similar functions may be expected in response to PAH xenobiotics, and the opposite expression patterns we observed compared with wheat could result from spatiotemporal differences ( e.g .…”

Section: Discussionmentioning

confidence: 99%

Recent hybridization and allopolyploidy reprogrammedSpartinamicroRNA expression under xenobiotic induced stress

Cavé‐Radet

Salmon

Canh

et al. 2019

Preprint

View full text Add to dashboard Cite

Xenobiotic detoxification is a common trait of all living organisms, necessary for developmental plasticity and stress tolerance. The gene set involved in this biological process is dubbed the xenome (i.e. involved in drug metabolism in mammals, degradation of allelochemicals and environmental pollutants by bacteria and plant communities). Recently, we found that allopolyploidy increased tolerance to xenobiotics (phenanthrene) in Spartina. To decipher the molecular mechanisms underlying this process, we examined how interspecific hybridization and genome doubling impact miRNAs expression under xenobiotic induced stress. In this work we used a deep sequencing approach, and analyzed the parental species S. alterniflora and S. maritima, their F1 hybrid S. x townsendii and the allopolyploid S. anglica under phenanthrene exposure. We found that hybridization and genome doubling reprogrammed a myriad of miRNAs under phenanthrene-induced stress. Hence, to identify the master miRNAs involved in phenanthrene tolerance, we performed experimental functional validation of phenanthrene-responsive Spar-miRNAs using Arabidopsis T-DNA mutant lines inserted in homologous MIR genes, 39 knock out T-DNA Arabidopsis mutants, tagged in the most conserved miRNAs genes in vascular plants were screened. Development of MIR159 and MIR156 mutants was significantly affected under phenanthrene-induced stress. Subsequently, we performed in planta experimental validation to confirm the interaction between these miRNAs and their targets. These analyses suggest that MIR159 and MIR156 regulatory modules were targeted to induce the xenome relaxation and impact developmental plasticity responses in phylogenetically distant species under xenobiotic-induced stress. Graphical abstract

show abstract

The MicroRNA156 system: A tool in plant biotechnology

Cited by 31 publications

References 135 publications

Alfalfa response to heat stress is modulated by microRNA156

Alfalfa response to heat stress is modulated by microRNA156

Characterizing the Role of the miR156-SPL Network in Plant Development and Stress Response

Recent hybridization and allopolyploidy reprogrammedSpartinamicroRNA expression under xenobiotic induced stress

Contact Info

Product

Resources

About