The Molecular Mechanisms of the Hepatoprotective Effect of Gomisin A against Oxidative Stress and Inflammatory Response in Rats with Carbon Tetrachloride-Induced Acute Liver Injury

Teraoka, Ryutaro; Shimada, Tsutomu; Aburada, Masaki

doi:10.1248/bpb.35.171

Cited by 36 publications

(25 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…et Wils., is a well-known traditional Chinese herb that is widely used as a tonic or adjuvant drug in Asia (Panossian and Wikman, 2008). Numerous studies have demonstrated the potent, beneficial effect of Schisandra sphenanthera on immunity and heart and kidney function as well as for hepatoprotection against chemical hepatitis and various hepatotoxins (Zhu et al, 2000;Panossian and Wikman, 2008;Teraoka et al, 2012). Wuzhi tablet (WZ), an ethanol extract preparation of Schisandra sphenanthera, is commonly used for the treatment of chronic viral hepatitis and liver dysfunction in a clinical setting, and is indexed in the pharmacopoeia of the People's Republic of China .…”

Section: Introductionmentioning

confidence: 99%

Schisandra sphenanthera Extract Facilitates Liver Regeneration after Partial Hepatectomy in Mice

Fan

et al. 2016

Drug Metabolism and Disposition

View full text Add to dashboard Cite

Liver regeneration after surgical liver resection is crucial for the restoration of liver mass and the recovery of liver function. Schisandra sphenanthera extract (Wuzhi tablet, WZ) is a preparation of an extract from the dried ripe fruit of Schisandra sphenanthera Rehd. et Wils, a traditional hepatoprotective herb. Previously, we found that WZ could induce liver regeneration-related genes against acetaminopheninduced liver injury. However, whether WZ can directly facilitate liver regeneration after liver resection remains unknown. We investigated whether WZ has potential in promoting liver regeneration after a partial hepatectomy (PHX) in mice. Remnant livers were collected 1, 1.5, 2, 3, 5, 7, and 10 days after PHX. Hepatocyte proliferation was assessed using the Ki-67 labeling index. Western blot analysis was performed on proteins known to be involved in liver regeneration. The results demonstrated that WZ significantly increased the liver-to-body weight ratio of mice after PHX but had no effect on that of mice after a sham operation. Additionally, the peak hepatocyte proliferation was observed at 1.5 days in PHX/WZ-treated mice but at 2 days in PHX/saline-treated mice, as evidenced by the Ki-67 positive ratio. Furthermore, WZ significantly increased the protein expression of ligand-induced phosphorylation of epidermal growth factor receptor and up-regulated cyclin D1, cyclin D-dependent kinase 4, phosphorylated retinoblastoma, and proliferating cell nuclear antigen protein expression and down-regulated the expression of cell cycle inhibitors p21 and p27 in the regenerative process after PHX. These results demonstrate that WZ significantly facilitates hepatocyte proliferation and liver regeneration after PHX.

show abstract

Section: Introductionmentioning

confidence: 99%

Schisandra sphenanthera Extract Facilitates Liver Regeneration after Partial Hepatectomy in Mice

Fan

et al. 2016

Drug Metabolism and Disposition

View full text Add to dashboard Cite

show abstract

“…(f) Nutrients BCAA-enriched diet in DEN treated rats (Cha et al 2013) Decreased mRNA levels for markers of fibrosis, angiogenesis, and apoptosis inhibition LA in TAA-treated rats (Foo et al 2011) Reduction in cirrhosis incidence, hepatic fibrosis, and AST/ALT activities Omega-3 in CCl4-treated rats (Shaaban et al 2014) Counteracting hepatic oxidative stress and augmenting hepatic antioxidants, reducing α-SMA expression, down-regulating PDGF-β expression, and inhibiting the fibrogenesis response (g) Traditional Chinese medicine In CCL4-induced fibrosis model, Panax notoginseng, Huisheng oral solution, saikosaponin-d, hydroxysafflor yellow A, Paeonia lactiflora and Astragalus, dahuangzhechong pills, and gomisin A were effective (Cai et al 2010;Dang et al 2007;Li et al 2014c;Peng et al 2009b;Sun et al 2007;Teraoka et al 2012;Zhang et al 2012) Reduced inflammatory cytokines, alleviated liver fibrosis…”

Section: Resultsmentioning

confidence: 99%

Strategies to prevent and reverse liver fibrosis in humans and laboratory animals

Chen

Wang

2015

Arch Toxicol

View full text Add to dashboard Cite

Liver fibrosis results from chronic damage to the liver in conjunction with various pathways and is mediated by a complex microenvironment. Based on clinical observations, it is now evident that fibrosis is a dynamic, bidirectional process with an inherent capacity for recovery and remodeling. The major mechanisms involved in liver fibrosis include the repetitive injury of hepatocytes, the activation of the inflammatory response after injury stimulation, and the activation and proliferation of hepatic stellate cells (HSCs), which represents the major extracellular matrix (ECM)-producing cells, stimulated by hepatocyte injury and inflammation. The microenvironment in the liver is synergistically regulated abnormal ECM deposition, scar formation, angiogenesis, and fibrogenesis. Moreover, recent studies have clarified novel mechanism in fibrosis such as epigenetic regulation of HSCs, the leptin and PPARγ pathways, the coagulation system, and even autophagy. Uncovering the mechanisms of liver fibrogenesis provides a basis to develop potential therapies to reverse and treat the fibrotic response, thereby improving the outcomes of patients with chronic liver disease. Although both scientific and clinical challenges remain, emerging studies attempt to reveal the ideal anti-fibrotic drug that could be easily delivered to the liver with high specificity and low toxicity. This review highlights the mechanisms, including novel pathways underlying fibrogenesis that may be translated into preventive and treatment strategies, reviews both current and novel agents that target specific pathways or multiple targets, and discusses novel drug delivery systems such as nanotechnology that can be applied in the treatment of liver fibrosis. In addition, we also discuss some current treatment strategies that are being applied in animal models and in clinical trials.

show abstract

“…Mouse Gene Forward primer Reverse primer mGRP78 mCHOP mXBP-1 mTNF-α mIL-6 mMCP-1 GAAAGGATGGTTAATGATGCTGAG CAGTCATGGCAGCTGAGTCC GAG TCC GCA GCA GGT G CCCTCACACTCAGATCATCTTCT TAGTCCTTCCTACCCCAATTTCC GCATCCACGTGTTGGCTCA GTCTTCAATGTCCGCATCCTG TAGGTGCCCCCAATTTCATC GTG TCA GAG TCC ATG GGA GCTACGACGTGGGCTACAG TTGGTCCTTAGCCACTCCTTC CTCCAGCCTACTCATTGGGATCA oxidative, and anti-inflammatory effects [11,13,16,24]. Table 1.…”

Section: Introductionmentioning

confidence: 99%

Gomisin A Ameliorates Endoplasmic Reticulum Stress-induced Hepatic Steatosis

Yun¹,

Jung²

2017

Journal of Life Science

View full text Add to dashboard Cite

Previously, we have shown that Schisandra chinensis (Turcz.) Baill. (S. chinensis) has a protective effect against endoplasmic reticulum (ER) stress-induced hepatic steatosis. Gomisin A is a bioactive phytoestrogen derived from S. chinensis. In the present study, the in vitro and in vivo effects of gomisin A on ER stress and hepatic steatosis were investigated. We quantified the expression of markers of ER stress, including glucose regulated protein 78 (GRP78), C/EBP homolog protein (CHOP), and X-boxbinding protein-1 (XBP-1), in HepG2 cells treated with tunicamycin or palmitate. Tunicamycin treatment in HepG2 cells induced the expression of markers of ER stress, including GRP78, CHOP, and XBP-1c. However, treatment with gomisin A reduced the expression of markers of ER stress. These inhibitory effects were also observed in palmitate-incubated HepG2 cells. The in vivo inhibitory effects of gomisin A were assessed in mice injected with tunicamycin or fed with a high fat diet (HFD). Gomisin A reduced the expression of markers of ER stress and decreased triglyceride levels in the livers of mice after tunicamycin injection or HFD feeding. Furthermore, gomisin A decreased the expression of inflammatory genes in palmitate-incubated HepG2 cells and the liver of HFD-fed obese mice. These results suggest that gomisin A inhibits ER stress and ameliorates hepatic steatosis induced by ER stress.

show abstract

The Molecular Mechanisms of the Hepatoprotective Effect of Gomisin A against Oxidative Stress and Inflammatory Response in Rats with Carbon Tetrachloride-Induced Acute Liver Injury

Cited by 36 publications

References 38 publications

Schisandra sphenanthera Extract Facilitates Liver Regeneration after Partial Hepatectomy in Mice

Schisandra sphenanthera Extract Facilitates Liver Regeneration after Partial Hepatectomy in Mice

Strategies to prevent and reverse liver fibrosis in humans and laboratory animals

Gomisin A Ameliorates Endoplasmic Reticulum Stress-induced Hepatic Steatosis

Contact Info

Product

Resources

About