The phylogeny of thrips (Thysanoptera: Thripidae) based on partial sequences of cytochrome oxidase I, 28S ribosomal DNA and elongation factor-1 α and the association with vector competence of tospoviruses

Abstract

The phylogenetic relationships among 16 species including 10 thrips vector species of tospoviruses were analysed using partial sequences of three genes: mitochondrial COI, nuclear 28S ribosomal DNA and the elongation factor-1a (EF-1a) in order to reveal the influence of lineage among thrips vector species on the vector competence of tospoviruses. The phylogenetic trees of thrips suggested that distinct clades were formed between the genera Frankliniella and Thrips including vector species at least in combined nuclear DNA data, although COI data showed a similar result despite low bootstrap value in the root of Thrips clade. Scirtothrips had an ambiguous phylogenetic position in this study. Vector and non-vector species were found within the same clade in the genus Thrips. Compared with the phylogenetic tree of thrips, the virus phylogeny inferred from the nucleocapsid (N) protein sequence were likely to correspond to the phylogeny of thrips, genera Frankliniella, Thrips and Scirtothrips, respectively, and also to the primary host plants under natural conditions. These results suggested that the vector competence of thrips for tospoviruses might be influenced by the lineages of thrips vectors as well as host plants.

Upregulation of temperature susceptibility in Bemisia tabaci upon acquisition of Tomato yellow leaf curl virus (TYLCV)

“…Similar effects of plant viruses have also been reported in other insects. For example, the adult lifespan of thelytokous Thrips tabaci is shortened upon infection by Tomato spotted wilt virus (TSWV) (Inoue and Sakurai, 2006). Rubinstein and Czosnek (1997) suggested that the negative effect plant virus infection has on vector longevity is a deleterious feature reminiscent of an insect pathogen.…”

Rapid diagnosis of the invasive species, Frankliniella occidentalis (Pergande): a species‐specific COI marker

“…One pair of F. occidentalis ‐specific primers FOCZ‐1F/FOCZ‐1R was designed based on a known mitochondrial cytochrome oxidase I gene sequence (556 bp, GenBank Accession No: ; Inoue and Sakurai 2007) of the western flower thrips. The sequence of the 5′ upstream primer (FOCZ‐1F) was 5′‐TTGACTTCTTCCACCCTCT‐3′, corresponding to the region from bases 20–38, and the 3′ downstream primer (FOCZ‐1R) was 5′‐TGTATTTAAGTTTCGGTCTG‐3′, corresponding to bases 340–359 (Inoue and Sakurai 2007). The primers were synthesized by Shanghai Shenggong Biotechnological Ltd (Shanghai, China).…”

“…Two microlitres of extracted DNA was used as the template for PCR. corresponding to bases 340-359 (Inoue and Sakurai 2007). The primers were synthesized by Shanghai Shenggong Biotechnological Ltd (Shanghai, China).…”

A molecular identification key for economically important thrips species (Thysanoptera: Thripidae) in southern Africa

“…To increase the data set, sequences of species included in the studies of Brunner et al (2002) and Inque & Sakurai (2007) as well as additional species obtained from GenBank ( Fig. 1), were included in statistical analyses.…”

“…A system of identifying economically important thrips species present in Europe was developed by Brunner et al (2002), based on nucleotide sequence analysis of the mitochondrial cytochrome oxidase (COI) gene, which has since been confirmed to be a suitable marker for thrips species identification ). More recently, nucleotide sequences of various genes, including the COI gene, of virustransmitting thrips species present in Japan were provided by Inque & Sakurai (2007), as part of an attempt to study the association of viruses with their thrips vectors. However, although several species of thrips of economic importance in South Africa were included in the aforementioned studies, various damaging endemic species lack reliable means of identification.…”