The role of testicular nuclear receptor 4 in chemo-resistance of docetaxel in castration-resistant prostate cancer

Abstract

Docetaxel-based therapy is one of the first-line options for castration-resistant prostate cancer (CRPC). However, a large proportion of CRPC patients show different extents of docetaxel resistance. The current study aims to investigate the role of testicular nuclear receptor 4 (TR4) in docetaxel resistance in CRPC. TR4 expression level in prostate biopsy samples from CRPC patients treated with docetaxel was measured by immunohistochemistry (IHC). Alternation of TR4 expression in prostate cancer (PCa) cell line PC3 was applied to find out the influence of TR4 on half-maximal inhibitory concentration (IC50), cell viability and cell apoptosis. Patients who failed to achieve prostate-specific antigen (PSA) response (<50% PSA reduction from baseline) after docetaxel-based chemotherapy had a comparatively higher TR4 expression than those who achieved PSA response (⩾50% PSA reduction from baseline). Knocking down TR4 in PC3 cells led to a lower IC50 dose, poorer cell viability and more cell apoptosis when treated with docetaxel, whereas overexpression of TR4 in PC3 led to a higher IC50 dose, better cell viability and less cell apoptosis. TR4 enhances the chemo-resistance of docetaxel in CRPC. It may serve as a biomarker to determine the prognosis of docetaxel-based therapy and as a potential therapy target to combine with docetaxel to better suppress CRPC.

The prognostic utility of the transcription factor SRF in docetaxel-resistant prostate cancer: in-vitro discovery and in-vivo validation

“…(2) BRN5, a pou domain TF of which very little is known, and (3) TR2 and TR4; members of the orphan nuclear receptor family, for which activation or deactivation involves an intricate interplay of different structural classes of endogenous ligands such as the heterodimeric receptors that partner with the retinoid X receptor and bind retinoids and vitamin D [ 35 ]. In support of our findings, in recent months Chen et al demonstrated that TR4 enhances the chemo-resistance of docetaxel in CRPC, and that it may serve as a biomarker to determine the prognosis of docetaxel-based therapy [ 36 ].…”

Preclinical studies using miR‐32‐5p to suppress clear cell renal cell carcinoma metastasis via altering the miR‐32‐5p/TR4/HGF/Met signaling

“…[4][5][6] Earlier studies from TR4 knockout (TR4KO) mice revealed that TR4 might play important roles in fertility, bone formation, neural development and metabolism. [7][8][9][10][11] Recent studies also found TR4 might play a negative role to suppress prostate cancer (PCa) initiation, yet played a positive role to promote PCa metastasis, [12][13][14] which is opposite the androgen receptor that promotes PCa initiation and suppresses PCa metastases. 15 These contrasting results prompted us to investigate TR4 potential impacts on the ccRCC progression.…”

Testicular orphan nuclear receptor 4 is associated with the radio-sensitivity of prostate cancer

“…Extraction of total RNA and synthesize of cDNA was performed as described previously . Quantitative real‐time PCR was performed using the TIANGEN® Real Master Mix (SYBR Green) and ABI 7500 real‐time PCR system (Applied Bio‐Systems, USA).…”

“…GAPDH served as an internal control. The primers of TR4 and GAPDH were designed as described respectively : TR4 forward (5′‐ggctctgaacctgcctctg‐3′), TR4 reverse (5′‐aggatgaactgctgtttggg‐3′), GAPDH forward (5′‐ggagtcaacggatttggt‐3′), and GAPDH reverse (5′‐gtgatgggatttccattgat‐3′). The reaction conditions were 95°C 2 min, followed by 40 cycles of 95°C 30 sec, 60°C 30 sec, 68°C 1 min, with a final extension at 72°C for 10 min.…”

“…Knocking down TR4 may lead to increased DNA damage with altered DNA repair in normal prostate epithelial cells . It has been illuminated that TR4 can modulate DNA repair specifically through the transcription‐coupled nucleotide excision repair pathway , and TR4 might enhance the PCa cells' chemo‐resistance to genotoxic chemotherapy drugs . However, the relationship between TR4 and PCa's radio‐sensitivity remains unclear.…”