The Spectrum ofβ-Thalassemia Mutations in a Population from the Brazilian Amazon

Abstract

The spectrum of β-thalassemia (β-thal) mutations was investigated for the first time in a cohort of 33 unrelated patients from the Brazilian Amazon attending the Center for Hemotherapy and Hematology of the Pará Foundation (HEMOPA), in Belém, the state capital of Pará, Northern Brazil. Identification of the β-thal mutations was made by direct genomic sequencing of the β-globin gene. Mutations were identified in all patients, corresponding to a spectrum of 10 different point mutations and a total of 37 alleles studied. HBB: c.92 + 5G > A [IVS-I-5 (G > A)], was the most common β-thal mutation, followed by HBB: c.118C > T [codon 39 (C > T)], HBB: c.-138C > T [-88 (C>T)], HBB: c.92 + 1G > A [IVS-I-1 (G > A)] and HBB: c.92 + 6T > C [IVS-I-6 (T > C)] mutations. These five mutations (four Mediterranean origin and one African origin) accounted for 86.5% of the β-thal alleles. The profile of β-thal mutations found in northern Brazil is different from those described in other regions of the country. In the southeast and south, the nonsense mutation HBB: c.118C > T is the most prevalent, followed by HBB: c.93-21G > A [IVS-I-110 (G > A)], whereas in the northeast, HBB: c.92 + 6T > C has been identified as the most common mutation, followed by HBB: c.92 + 1G > A. This heterogeneous geographical distribution is certainly related to the ancestry of Brazilian populations because they have similar genetic backgrounds (European, African and Amerindian), although with slightly different admixture proportions. Furthermore, the European contribution in the southeast and south was largely made up of immigrants of other nationalities, such as Italian and Spanish, in addition to Portuguese.

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

“…Most of the β‐thal mutations observed in our patients are of Mediterranean origin (10/21), including the four most common mutations (Cd 39 C>T, IVS1:1 G>A, IVS1:110 G>A, and δβ‐thal Spanish) (Table ), and this is consistent with the origins of Mexican mestizo population, which is mainly of Spaniard origin . The most frequent mutation, Cd 39 C>T (37.2%), is also the most common in Venezuela (34.1%), Brazil (36.8%), Cuba (30.5%), and Argentina (42.6%); this mutation has been observed all over the world …”

“…The IVS1:1 G>A and IVS1:110 G>A mutations have similar frequencies in our population (17.3% and 13.9%, respectively) (Table ); these mutations have also been observed in Venezuela (11.1% and 6.6%, respectively), Brazil (9.5% and 15.5%), Cuba (6.1% and 8.5%), and Argentina (11.1% and 21.7%) …”

“…The mutation IVS1:6 T>C was observed for the first time in our population, and it is a very frequent mutation in Mediterranean countries, ranging from 0.1% (Sardinia) to 70% (Malta) . It has also been observed in some countries of Latin America such as Venezuela (6.6%), Brazil (6‐12.9%), Cuba (3.7%) and Argentina (7.9%) . The mutation IVS1:5 G>A (4.4% in our population) has also been found in Venezuela (6.6%), Brazil (24.8%), and Cuba (3.7%) .…”

“…A similar mutation (‐90 C>T) was associated with an eightfold decreased transcription rate of the HBB gene . In the proximal CACCC sequence, there are at least nine different previously described mutations, of which only four have been observed in Latin American populations: ‐90 C>T has been observed in Jamaica with a frequency of 1.0%; ‐88 C>T in Venezuela (6.0%), Brazil (1.6%), and Cuba (2.4%); ‐87 C>T in Mexicans and Argentineans in 0.8% each; and ‐86 C>G in Venezuela (2.2%) …”

Use of >100,000 NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium whole genome sequences improves imputation quality and detection of rare variant associations in admixed African and Hispanic/Latino populations

“…The Sardinian population is represented in the HRC reference panel (~3500 individuals), which likely contributes to the reasonable imputation quality observed using HRC in most but not all cohorts, in contrast to the absence of this variant in 1000G, though imputation quality was clearly improved with the TOPMed freeze 5b reference panel. The p.Gln40Ter mutation is much less prevalent outside of the WesternMediterranean, but has been detected among individuals with beta thalassemia among admixed populations from Central and South America(34,35), which are geographically and genetically similar to some of the Hispanic/Latino samples included in our imputation-based discovery sample. While the individuals carrying the HBB p.Gln40Ter allele in our unselected populationbased Hispanic/Latino sample were all imputed heterozygotes (consistent with "thalassemia minor" and generally considered healthy), there is increasing evidence that silent carriers of betathalassemia and sickle cell mutations may be at risk for various health-related conditions(36,37).…”