The Surface‐Exposed, Trypsin‐Accessible Segments of Apolipoprotein B in the Low‐Density Lipoprotein of Human Serum

Chapman, M. John; Millet, Anne; Lagrange, Dominique; Goldstein, Sonia; Blouquit, Y.; Taylaur, C.E.; Mills, G.L.

doi:10.1111/j.1432-1033.1982.tb06708.x

Cited by 17 publications

(3 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Trypsin and Pm were able to cleave apoB100 in LDL. Consequently, small peptides were released from the LDL particle [ 32 , 33 , 34 ]. These enzymatically modified LDLs (ELDL) induced foam cell formation in macrophages [ 17 ], stimulated MCP-1 production [ 35 ], and promoted the adhesion of monocytes to the endothelial cell layer [ 36 ].…”

Section: Discussionmentioning

confidence: 99%

Plasminogen Deficiency Significantly Reduces Vascular Wall Disease in a Murine Model of Type IIa Hypercholesterolemia

et al. 2021

View full text Add to dashboard Cite

The fibrinolytic system has been implicated in the genesis and progression of atherosclerosis. It has been reported that a plasminogen (Pg) deficiency (Plg−/−) exacerbates the progression of atherosclerosis in Apoe−/− mice. However, the manner in which Plg functions in a low-density lipoprotein-cholesterol (LDL-C)-driven model has not been evaluated. To characterize the effect of Pg in an LDL-C-driven model, mice with a triple deficiency of the LDL-receptor (LDLr), along with the active component (apobec1) of the apolipoprotein B editosome complex, and Pg (L−/−/A−/−/Plg−/−), were generated. Atherosclerotic plaque formation was severely retarded in the absence of Pg. In vitro studies demonstrated that LDL uptake by macrophages was enhanced by plasmin (Pm), whereas circulating levels of LDL were enhanced, relative to L−/−/A−/− mice, and VLDL synthesis was suppressed. These results indicated that clearance of lipoproteins in the absence of LDLr may be regulated by Pg/Pm. Conclusions: The results from this study indicate that Pg exacerbates atherosclerosis in an LDL-C model of atherosclerosis and also plays a role in lipoprotein modification and clearance. Therefore, controlling the Pg system on macrophages to prevent foam cell formation would be a novel therapeutic approach.

show abstract

Section: Discussionmentioning

confidence: 99%

Plasminogen Deficiency Significantly Reduces Vascular Wall Disease in a Murine Model of Type IIa Hypercholesterolemia

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Reference Chen et al 5 Knott et al°L aw et al 8 Cladaras et al 9 Ludwig et al 40 Carlson et al 53 Hardman et al 52 Protter et al M Chen et al …”

Section: Table 3 Number Of Nucleotlde Differences Per Nonsynonymous mentioning

confidence: 99%

Structure of apolipoprotein B-100 of human low density lipoproteins.

et al. 1989

View full text Add to dashboard Cite

We have analyzed low density lipoproteins (LDL) apolipoprotein (apo) B structure by direct sequence analysis of LDL apo B-100 tryptlc peptides. Native LDL were digested with trypsin, and the products were fractionated on a Sephadex G-50 column. The partially digested apo B-100 still associated with liplds was recovered In the void volume (designated trypsln-nonreleasable, TN, peptides). The released peptides (designated trypsln-releasable, TR, peptides) in subsequent peaks were repurifled on two successive high-performance liquid chromatogaphy (HPLC) columns. The TN peak was dellpidated and redigested with trypsin, and the resulting peptides were purified on two successive HPLC columns. Using this approach, we sequenced over 88% of LDL apo B-100, extending and refining our previous study (Nature 1986;323:738-742) which covered 52% of the protein. TN peptides made up 31%, and the TR peptides, 34% of the apo B-100 sequence; 23.7% were found under both TN and TR categories. Based on its differential trypsin releasabllity, apo B-100 can be divided into five domains: 1) residues 1-1000, largely TR; 2) residues 1001-1700, alternating TR and TN; 3) residues 1701-3070, largely TN; 4) residues 3071-4100, mainly TR and mixed; and 5) residues 4101-4536, almost exclusively TN. Domain 1 contained 14 of the 25 Cys residues In apo B. Domain 4 encompassed seven N-glycosylatIon sites, and contained the putative receptor binding domains. All 19 potential N-glycosylatlon sites were directly sequenced: 16 were found to be glycosylated and three were not Three pairs of dlsurfide bridges were also mapped. Finally, a combination of cDNA sequencing, direct mRNA sequencing, and comparison of published apo B-100 sequences allowed us to Identify specific amino acid residues within apo B-100 that seem to represent bona fide allellc variations. Our study provides information on LDL apo B-100 structure that will be important to our understanding of its conformation and metabolism. (Arteriosclerosis 9:96-108, January/February 1989) L ow density lipoproteins (LDL) are the major carriers of cholesterol in plasma, and their increased concentration in circulation is correlated with the development of atherosclerosis. 12 In normal individuals, very low density lipoproteins (VLDL) are the major precursor lipoproteins of plasma LDL. LDL are removed from the circulation by both high-affinity receptor-mediated 3 and receptor-independent 4 pathways, the liver being the major organ responsible for LDL clearance. Apoprotein (apo) B-100 is the major protein constituent in LDL and is the ligand recognized by the LDL receptor.The complete sequence of apo B-100 has been recently deduced from its cDNA sequence. 5 -8 It is one of the largest monomeric proteins known, with a calculated

show abstract

“…The junction region of B-26 and B-74 could represent a part of the B-100 protein which, when present in its native conformation on plasma LDL, is exposed to the aqueous environment and, as a result, is accessible to kallikrein. Such protease-sensitive sites on apoB have been described (20).…”

Section: Discussionmentioning

confidence: 98%

Analysis of cDNA clones encoding the entire B-26 region of human apolipoprotein B.

Protter¹,

Hardman²,

Sato³

et al. 1986

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

We report the characterization of intestine and liver cDNA clones for human apolipoprotein B (apoB) that map to the 5' end of the mRNA. The protein sequence encoded by the 5011 nucleotides derived from sequence analysis of these clones includes 1643 amino acid residues of the mature protein ofMr 184,000. The amino acid sequence at the amino terminus of B-74 peptide was determined and mapped to residue 1298. The size (Mr 145,700) and amino acid composition of the B-26 region encoded by these clones (including amino acid residues 1-1297) closely match the values obtained from the B-26 peptide.The amino acid sequence of psptide B-100 at the junction of peptides B-26 and B-74 (Phe-Lys-Ser) shows structural homology to the site on human kininogen (Phe-Arg-Ser) (4).Two immunochemically related forms ofhuman apoB, B-100 (Mr 550,000) and B-48 (Mr 280,000), have been described (5), each with its own principal metabolic pathway. The B-48 form of apoB is secreted from the intestinal epithelium into the mesenteric lymph in chylomicrons (2). The B-100 form ofapoB is secreted from the liver associated initially with VLDL, and then, after processing of the particle in the blood, with LDL.' Although the exact relationship between B-100 and B-48 is not known, various immunological and structural studies indicate that the two forms have some homology (2).Two additional plasma forms of apoB, B-74 (Mr 407,000) and B-26 (Mr 144,000), have also been described (5). Amino acid composition data suggest that peptides B-74 and B-26 are fragments of B-100. Fragments of similar molecular weight to those of B-74 and B-26 can be obtained in vivo by treating LDL with the proteolytic enzyme plasma kallikrein (6, 7). Recent studies (8) have mapped the B-26 fragment to the amino terminus of B-100. The precise mechanism by which these two apoB peptides are formed in the blood and their physiological significance is not known. Progress in elucidating the structure of apoB is being made through the characterization of cDNA clones. Several groups (8-15) have presented human or rat liver cDNA clones representing a part of the apoB mRNA. Knott et al. (9) have described human liver cDNA clones that code for the 1455 carboxyl-terminal amino acids. We have presented the sequence of a human liver cDNA clone that includes part of the 5' nontranslated region, the signal peptide, and 350 amino acids from the amino terminus (8). In this report we extend the characterization of B-100 protein encoded by cDNA clones of both the liver and the intestine. The 5010 base pairs analyzed code for the amino-terminal 1643 amino acids of B-100.MATERIALS AND METHODS Materials. The 21-base oligonucleotide probe B 1147, CAGCCGCTTCTllTGGTGAAGG, the 22-base oligonucleotide probe B 1254, TCCTCCAGAAGTCTAAAGATGT, and other 17-base oligonucleotides that were used for sequence analysis were prepared as described (8). Radioisotopes were from Amersham, and all restriction enzymes were from New England Biolabs.Purification and Sequence Analysis of B-74 and Fragments of B-26...

show abstract

The Surface‐Exposed, Trypsin‐Accessible Segments of Apolipoprotein B in the Low‐Density Lipoprotein of Human Serum

Cited by 17 publications

References 51 publications

Plasminogen Deficiency Significantly Reduces Vascular Wall Disease in a Murine Model of Type IIa Hypercholesterolemia

Plasminogen Deficiency Significantly Reduces Vascular Wall Disease in a Murine Model of Type IIa Hypercholesterolemia

Structure of apolipoprotein B-100 of human low density lipoproteins.

Analysis of cDNA clones encoding the entire B-26 region of human apolipoprotein B.

Contact Info

Product

Resources

About