The synthesis of modified achiral internucleoside linkages: -NHCH2CH2- linked oligonucleosides

Schairer, Wayne C.; Waychunas, Cheryl; Prasad, C. V. C.; Sardaro, Mark; Upso, Donald A.; Kruse, Lawrence I.

doi:10.1016/s0040-4039(00)61716-1

Cited by 13 publications

(3 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Imidazole (Nacalai Tesque), N- (methyl)imidazole (Nacalai Tesque), N- (phenyl)imidazole (Aldrich), N- ( p -acetylphenyl)imidazole (Aldrich), 2-(phenyl)imidazole (Nacalai Tesque), 4-(methyl)imidazole (Kishida), 4-(phenyl)imidazole (Tokyo Kasei), benzimidazole (Nacalai Tesque), N- (methyl)benzimidazole (Wako), 2-(methyl)benzimidazole (Nacalai Tesque), 2-(phenyl)benzimidazole (Nacalai Tesque), trifluoromethanesulfonic acid (Central Glass), p- toluenesulfonic acid (Aldrich), trifluoroacetic acid (Kishida), hydroperchloric acid (Wako), tetrafluoroboric acid (Aldrich), hexafluorophosphoric acid (Aldrich), N 6 -(benzoyl)-5‘- O -( p,p ‘-dimethoxytrityl)-2‘-deoxyadenosine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 5 ) (Glen Research), N 4 -(acetyl)-5‘- O -( p,p ‘-dimethoxytrityl)-2‘-deoxycytidine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 6 ) (Glen Research), N 2 -(isobutyryl)-5‘- O -( p,p ‘-dimethoxytrityl)-2‘-deoxyguanosine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 7 ) (Glen Research), and 5‘- O -( p,p ‘-dimethoxytrityl)thymidine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 8 ) (Glen Research), Primer Support T ( 41 ) (Amersham Pharmacia Biotech), N 6 -(phenoxyacetyl)-5‘- O -( p,p ‘-dimethoxytrityl)-2‘-deoxyadenosine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 42 ) (Amersham Pharmacia Biotech), N 2 -( p -isopropylphenoxyacetyl)-5‘- O -( p,p ‘-dimethoxytrityl)-2‘-deoxyguanosine 3‘-(2-cyanoethyl N , N -diisopropylphosphoramidite) ( 43 ) (Amersham Pharmacia Biotech), the uridine derivative anchored on CPG ( 45 ) (pore size, 500 Å, Milligen or Glen Research), a 2-butanone peroxide/dimethyl phthalate solution (Kishida), and Pd[P(C 6 H 5 ) 3 ] 4 (Aldrich) were commercially supplied. The following compounds and a solution are reported in the literature or prepared by reported methods: azolium salts imidazolium triflate,25f imidazolium perchlorate N -(methyl)imidazolium triflate, N -(phenyl)imidazolium perchlorate, and benzimidazolium triflate;25a protected 2‘-deoxyribonucleoside 3‘-phosphoramidites 1 , 45c, 2 , 45c, 3 , 45c, and 4 ;45c 3‘- O -protected 2‘-deoxyribonucleosides 9 ,45a 10 , and 11 ; dideoxyribnonucleoside phosphates 17 , 18 , and 19 ;25a protected ribonucleoside 3‘-phosphoramidites 20 , 21 ,40f and 22 ; 2‘,3‘- O -protected ribonucleosides 24 ,38c 25 ,38c and 26 ;38c 2‘- O -( tert -butyldimethylsilyl)-5‘- O -( p,p ‘-dimethoxytrityl)uridine; 3‘- O -( tert -butyldimethylsilyl)-5‘- O -( p,p ‘-dimethoxytrityl)-adenosine; a 1.0 M tert -butyl hydroperoxide/toluene solution; , (allyloxy)bis(diisopropylamino)phosphine;…”

Section: Methodsmentioning

confidence: 99%

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

et al. 2001

View full text Add to dashboard Cite

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

show abstract

Section: Methodsmentioning

confidence: 99%

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

et al. 2001

View full text Add to dashboard Cite

show abstract

“…3'-Amino-3'-deoxynucleosides are also the key intermediates in the synthesis of several backbone-modified oligonucleotides. For example, the phosphodiester in the natural oligonucleotides can be replaced by guanidine [6 ± 9], amide [10] [11], urea [12], carbamate [13], and aminoalkyl derivatives [14] [15]. Such antisense oligonucleotides may have great potential as therapeutic and diagnostic agents.…”

mentioning

confidence: 99%

“…Compound 14 was treated with a solution of 3.0n NaOH (aq.) MeOH 1 : 1 to yield 3'-(benzylamino)-3'-deoxyguanosine (15). The pure compound 15 (207 mg, 95% from 13) was obtained by the C18 reversed-phase chromatography eluted with a gradient from H 2 O to MeOH/H 2 O 1 : 1.…”

mentioning

confidence: 99%

An Efficient Synthesis of 3′‐Amino‐3′‐deoxyguanosine from Guanosine

Zhang

Cui

Zhang

2003

Helvetica Chimica Acta

View full text Add to dashboard Cite

Abstract3′‐Amino‐3′‐deoxyguanosine was synthesized from guanosine in eight steps and 58% overall yield. The 2′,3′‐diol of 5′‐O‐[(tert‐butyl)diphenylsilyl]‐2‐N‐[(dimethylamino)methylidene]guanosine was reacted with α‐acetoxyisobutyryl bromide and treated with 0.5n NH3 in MeOH to yield 9‐{2′‐O‐acetyl‐3′‐bromo‐5′‐O‐[(tert‐butyl)diphenylsilyl]‐3′‐deoxy‐β‐D‐xylofuranosyl]‐2‐N‐[(dimethylamino)methylidene]guanine, which was reacted with benzyl isocyanate, NaH, and then 3.0n NaOH, and finally with Pd/C (10%) and HCO2NH4 in EtOH/AcOH to afford 3′‐amino‐3′‐deoxyguanosine.

show abstract

ChemInform Abstract: The Synthesis of Modified Achiral Internucleoside Linkages: ‐NHCH2CH2‐ Linked Oligonucleosides.

et al. 1994

View full text Add to dashboard Cite

The Synthesis of Modified Achiral Internucleoside Linkages: -NHCH2CH2-Linked Oligonucleosides.-A methodology for the preparation of oligonucleotides uniformly bridged with the N-C-C internucleoside linkage is described with the synthesis of the completely protected thymidylate trimer (X). The bifunctional synthon (IV) derived from the azidothymidine (I), the 7'-aldehyde (V), and the aminothymidine (VIII) represent the key building blocks. -(SAHA, A. K.; SCHAIRER, W.; WAYCHUNAS, C.; PRASAD, C. V. C.; SARDARO, M.; UPSON, D. A.; KRUSE, L. I.; Tetrahedron Lett.

show abstract

The synthesis of modified achiral internucleoside linkages: -NHCH2CH2- linked oligonucleosides

Cited by 13 publications

References 17 publications

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

Acid/Azole Complexes as Highly Effective Promoters in the Synthesis of DNA and RNA Oligomers via the Phosphoramidite Method

An Efficient Synthesis of 3′‐Amino‐3′‐deoxyguanosine from Guanosine

ChemInform Abstract: The Synthesis of Modified Achiral Internucleoside Linkages: ‐NHCH2CH2‐ Linked Oligonucleosides.

Contact Info

Product

Resources

About