The three-dimensional folding of the tRNA-like structure of tobacco mosaic virus RNA. A new building principle applied twice

Abstract

The structure of the tRNA‐like 3′ terminus of tobacco mosaic virus (TMV) RNA has been studied. A 3′ ‐terminal fragment possessing the tRNA‐like properties was probed with chemical modification and enzymatic digestions. A model of the secondary structure is proposed for the last 105 nucleotides. The corresponding region of other tobamoviral RNAs can be folded in an identical secondary structure. A three‐dimensional model for the tRNA‐like structure is given which is compared with those proposed earlier for the tRNA‐like 3′ termini of turnip yellow mosaic virus (TYMV) RNA and brome mosaic virus (BMV) RNA. A new building principle which we discovered previously by studying the latter RNAs appears to be applied twice in the tRNA‐like structure of TMV RNA. The determination of the minimal length requirement for recognition of CTP, ATP:tRNA nucleotidyl‐transferase reveals a size of ˜100 nucleotides in agreement with the models proposed.

Comparison and functional implications of the 3D architectures of viral tRNA-like structures

“…In this study, our strategy was to use a combination of methods to first study the global conformations of representative TLSs and then to explore the detailed interactions that give rise to the structures, making no assumptions about the structure of these molecules at any level. As such, these studies expand on previous studies in which enzymatic and chemical probing of TLS secondary and tertiary structure interactions and the ability of these RNAs to functionally mimic tRNAs were used to generate 3D models (Rietveld et al 1983(Rietveld et al , 1984Dumas et al 1987;Felden et al 1994Felden et al , 1996Fechter et al 2001a) and also provide an independent testing of these models. Our results show that, consistent with previous studies, there are features of these TLSs that are reminiscent of tRNAs but also substantial diversity in their folds when compared with each other and with tRNA, and also reveal details of the folds and how they may act as multifunctional RNAs important for several tasks during viral infection.…”

“…One of these pseudoknots may be analogous to the D-T loop interaction; however, no evidence of an actual D-T loop-loop interaction has been reported ( Fig. 1E) (Rietveld et al 1984). In addition, directly upstream of the TMV TLS is an upstream pseudoknot domain (UPD) (Zeenko et al 2002).…”

“…The minimal length of the TYMV TLS for aminoacylation has been reported as 82 nucleotides (nt) (Mans et al 1990), the BMV TLS has been reported to require 134 nt for aminoacylation (although more efficient aminoacylation requires 169 nt) (Fechter et al 2001a), and the TMV TLS needs 106 nt (Rietveld et al 1984). While the 39 and 59 ends base pair in the acceptor stem in canonical tRNAs (Fig.…”

Nucleotide Sequences of 5' and 3' Non-coding Regions of Pepper Mild Mottle Virus Strain S RNA

“…4; van Belkum et al, 1985). Yet the sequence of the anticodon loop is the same only in PMMV-S, TMV-U2 and CGMMV (Rietveld et al, 1984;Garcla-Arenal, 1988). This has evolutionary and functional implications because it is believed that the interaction between this particular region of the RNA and the viral replicase must be mediated by specific signal sequences.…”

“…According to the primary sequence data, the last 181 nucleotides of PMMV-S R N A can be folded (Fig. 4) into threedimensional structures like those proposed for other tobamoviruses (Rietveld et al, 1984;van Belkum et al, 1985;Garcia-Arenal, 1988). The last 106 nucleotides can form a tRNA-like structure which can be charged with histidine (Rietveld et al, 1984;Garcla-Arenal, 1988 UA._~ACAUGAUGGCAUAAAUAAGUUGGACGAACAUUAAACGU* *GUGG* GAG*A*** UAAC U* G*AGUGUUUO*CCC*CCAC UUAAAOCGAAGGGUUGUCGU* 5 t ......... ************************************************************************************************************** 51 ...... UG_~AGGUAGUC*AGAUGCAUA******** ************************************************************** ************************ 51 UA,.~GCUAU*GUUGUGAGAOLIUCCUAAA*****GOC*C****GACUU*--***UUCAG***** *6***************4*********6 *********4 *A***C*A *****A*A ,,***u******.*******,***********.,.,.…”