Tissue, Developmental, and Tumor-Specific Expression of Divergent Transcripts in Wilms Tumor

Abstract

The Wilms tumor locus on chromosome 11p13 has been mapped to a region defined by overlapping, tumor-specific deletions. Complementary DNA clones representing transcripts of 2.5 (WIT-1) and 3.5 kb (WIT-2) mapping to this region were isolated from a kidney complementary DNA library. Expression of WIT-1 and WIT-2 was restricted to kidney and spleen. RNase protection revealed divergent transcription of WIT-1 and WIT-2, originating from a DNA region of less than 600 bp. Both transcripts were present at high concentrations in fetal kidney and at much reduced amounts in 5-year-old and adult kidneys. Eleven of 12 Wilms tumors classified as histopathologically heterogeneous exhibited absent or reduced expression of WIT-2, whereas only 4 of 14 histopathologically homogeneous tumors showed reduced expression. These data demonstrate a molecular basis for the pathogenetic heterogeneity in Wilms tumorigenesis.

Sequence of the WT1 Upstream Region Including the Wit-1 Gene

“…A second divergent transcript originating from this 568 GGGAAGCTGGGGGCAGCCAGGCAGCTGGGGTAAGGAGTTCAAG 610 mouse genomic locus was first described by Huang et al (6). The 2.1-kb Wit-1 sequence published closely resembles the one we have determined (11 deletions/insertions of single nucleotides and three substitutions in a total of 2013 nucleotides).…”

Restriction landmark genome scanning for aberrant methylation in primary refractory and relapsed acute myeloid leukemia; involvement of the WIT-1 gene

“…The WIT-1 gene is located approximately 1 kb upstream of the Wilms tumor gene, WT1 (Huang et al, 1990). Neither gene appears to be expressed in normal adult tissues, although WT1 is frequently expressed in diagnostic (Bergmann et al, 1997) and relapsed AML (Inoue et al, 1997).…”

“…It is located approximately 1 kb upstream of the Wilms tumor suppressor gene, WT1, and appears to be expressed coordinately with WT1 during kidney development and in Wilms tumor. There is evidence that WT1 and WIT-1 are bidirectionally transcribed from the same promoter region (Gessler and Bruns, 1993;Huang et al, 1990). Interestingly, despite its extremely restricted pattern of expression in normal tissues, WT1 is overexpressed in AML (Inoue et al, 1997).…”

The genomic organization and expression of the WT1 gene

“…The gene is expressed mainly during development of the kidney and genitourinary structures (Pritchard-Jones et al, 1990). There are seven independent cases of homozygous deletions of this gene described to date Cowell et al, 1991;Davis et al, 1991;Gessler et al, 1990;Huang et al, 1990;Huff et al, 1991;Ton et al, 1991). This clearly establishes that loss of WTl function must be an important factor in the development of tbese tumors.…”