Transcription Regulation of the rRNA Gene by a Multifunctional Nucleolar Protein, B23/Nucleophosmin, through Its Histone Chaperone Activity

Abstract

It is well established that the transcription rate of the rRNA gene is closely associated with profound alterations in the cell growth rate. Regulation of rRNA gene transcription is likely to be dependent on the dynamic conversion of the chromatin structure. Previously, we identified B23/nucleophosmin, a multifunctional nucleolar phosphoprotein, as a component of template activating factor III that remodels the chromatinlike structure of the adenovirus genome complexed with viral basic proteins. It has also been shown that B23 has histone chaperone activity. Here, we examined the effect of B23 on rRNA gene transcription. B23 was found to be associated with the rRNA gene chromatin. Small-interfering-RNA-mediated down-regulation of the B23 expression level resulted in reduction of the transcription rate of the rRNA gene. We constructed a B23 mutant termed B23⌬C, which lacks the domain essential for the histone chaperone activity and inhibited the histone binding activity of B23 in a dominant-negative manner. Expression of B23⌬C decreased rRNA gene transcription and the rate of cell proliferation. These results suggest that B23 is involved in the transcription regulation of the rRNA gene as a nucleolar histone chaperone.

Nucleolin and nucleophosmin: nucleolar proteins with multiple functions in DNA repair

“…Firstly, NPM1 is able to directly associate with rDNA repeats within the nucleolus and promote their transcription, potentially through its histone chaperone activities (Murano et al 2008). Secondly, NPM1 was found to associate with pre-rRNA within the nucleolus and mediate endonucleolytic cleavage within the Internal Transcribed Spacer 2 (ITS2), thereby separating the 28S and 5.8S rRNAs (Savkur and Olson 1998).…”

Phosphorylation of multifunctional nucleolar protein nucleophosmin (NPM1) by aurora kinase B is critical for mitotic progression

“…NPM1 undergoes a variety of post-translational modifications, such as phosphorylation, acetylation and sumoylation, that regulate its subcellular localization and functions [6,8]. NPM1 is phosphorylated by various kinases during different stages of the cell cycle [6]. NPM1 associates with unduplicated centrosomes, but upon phosphorylation at Thr199 by CDK2/cyclin E at the onset of mitosis, it dissociates from the centrosome, leading to centrosome duplication [9].…”

“…It possesses intrinsic histone chaperone activity [5], which allows it to regulate RNA polymerase I [6] and RNA polymerase II-dependent transcription [7]. NPM1 undergoes a variety of post-translational modifications, such as phosphorylation, acetylation and sumoylation, that regulate its subcellular localization and functions [6,8].…”

Centrosomal nucleolin is required for microtubule network organization

“…29,61,62 For B23 silencing, a mixture of siRNAs specific for human B23 was used (Invitrogen NPM1-HSS143152 GAUGGAACUCCACCCUUUGCUUGGU and NPM1-HSS143153 UGUAUGGAAUGUUAUGAUAGGA-CAU). 63 All siRNAs were reconstituted at a concentration of 100mM and stored at ¡20 C. As a control siRNA, we used stealth high GC siRNA (Invitrogen). Cells were transfected in a 6-well dishes using siRNA at 20nM final concentration.…”