Triacylglycerol, fatty acid, and phytochemical profiles in a new red sorghum variety (Ji Liang No. 1) and its antioxidant and anti‐inflammatory properties

Abstract

In this study, a new red sorghum variety (Ji Liang No. 1) was investigated for its triacylglycerol ( TAG ) and fatty acid profiles, carotenoid and tocopherol compositions, total phenolic, total flavonoid and phenolic acid contents, and antioxidant and anti‐inflammatory properties. A total of 17 TAG s were identified in the red sorghum oil. Linoleic and oleic acids were the primary fatty acids, contributing more than 80% of the total fatty acids. β‐Carotene was the primary carotenoid at a level of 26.14 μg/g. α‐, γ‐, and δ‐tocopherols were at levels of 0.19, 4.08, and 0.10 μg/g, respectively. Moreover, acetone–water (60:40, v/v) extract of the red sorghum exhibited the greatest total phenolic content of 2.77 mg GAE /g and total flavonoid content of 5.44 mg RE /g. The extract had scavenging capacities against DPPH , ABTS + , and peroxyl radicals and suppressed LPS stimulated IL ‐1β, IL ‐6, and COX ‐2 mRNA expressions in a dose‐dependent manner. Ferulic, p ‐coumaric, isoferulic, and p ‐hydroxybenzoic acids were found in the red sorghum, with ferulic acid as the predominant phenolic acid and mostly in an insoluble bound form. These data indicated a potential utilization of the red sorghum in health‐promoting functional food or supplemental products.

Polyphenol Containing Sorghum Brans Exhibit an Anti-Cancer Effect in Apc Min/+ Mice Treated with Dextran Sodium Sulfate

“…Several in vitro studies have reported on the strong antioxidative and anti-inflammatory capacity of sorghum compounds [ 5 , 6 ]. Moreover, sorghum consumption may be beneficial for the prevention of cancer.…”

Large-Scale Non-Targeted Metabolomics Reveals Antioxidant, Nutraceutical and Therapeutic Potentials of Sorghum

“…Speciality grain sorghum is reported to contain bioactive compounds such as phenolic compounds, including phenolic acids (benzoic and cinnamic acids), flavonoids (3-deoxyanthocyanidins), condensed tannins (proanthocyanidins, flavin-3-ols), lignin and stilbenes produced through phenylpropanoid pathway [9,16] possessing anti-microbial activity, and anti-inflammatory and anticancer activities [49,50]. Several in-vitro studies have reported on the strong anti-oxidative and anti-inflammatory capacity of sorghum compounds [51,52]. According to the phenolic profile and color, sorghum is broadly classified into five types: white, black, brown, red and yellow [40].…”

Chemical composition of tetraploid Gynostemma pentaphyllum gypenosides and their suppression on inflammatory response by NF‐κB/MAPKs/AP‐1 signaling pathways

“…Blank group was treated with DMEM only; LPS group was treated with LPS only; LPS + extracted gypenosides groups were pretreated with different concentrations of gypenosides for 1 hr and then stimulated with LPS (1 μg/ml) for 4 hr. RNA isolation and quantitative real‐time polymerase chain reaction (qRT‐PCR) were conducted according to a laboratory protocol (Zhang et al, ). Specific forward and reverse primer sequences used in this study were shown as follows: IL‐6 (Forward: 5′‐CACGGCCTTCCCTACTTCAC‐3′, Reverse: 5′‐TGCAAGTGCATCATCGTTGT‐3′); IL‐1β (Forward: 5′‐GTTGACGGACCCCAAAAGAT‐3′, Reverse: 5′‐CCTCATCCTGGAAGGTCCAC‐3′); TNF‐α (Forward: 5′‐CGAGTGACAAGCCTGTAGC‐3′, Reverse: 5′‐GGTGTGGGTGAGGAGCACAT‐3′); COX‐2 (Forward: 5′ ‐GGGAGTCTGGAACATTGTGAA‐3′, Reverse: 5′ ‐GCACGTTGATTGTAGGTGGACTGT‐3′); and β‐actin (Forward: 5′‐GGAATGGGTCAGAAGGACTC‐3′, Reverse: 5′‐CATGTCGTCCCAGTTGGTAA‐3′).…”

“…Blank group was treated with DMEM only; LPS group was treated with LPS only; LPS + extracted gypenosides groups were pretreated with different concentrations of gypenosides for 1 hr and then stimulated with LPS (1 μg/ml) for 4 hr. RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) were conducted according to a laboratory protocol (Zhang et al, 2019). Specific forward and reverse primer sequences used in this study were shown as follows: IL-6 (Forward: 5′-CACGGCCTTCCCTACTTCAC-3′, Reverse:…”