Tripeptide IRW Upregulates NAMPT Protein Levels in Cells and Obese C57BL/6J Mice

Abstract

Nicotinamide adenine dinucleotide (NAD+) plays a vital role in cellular processes that govern human health and disease. Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in NAD+ biosynthesis. Thus, boosting NAD+ level via an increase in NAMPT levels is an attractive approach for countering the effects of aging and metabolic disease. This study aimed to establish IRW (Ile-Arg-Trp), a small tripeptide derived from ovotransferrin, as a booster of NAMPT levels. Treatment of muscle (L6) cells with IRW increased intracellular NAMPT protein levels (2.2-fold, p < 0.05) and boosted NAD+ (p < 0.01). Both immunoprecipitation and recombinant NAMPT assays indicated the possible NAMPT-activating ability of IRW (p < 0.01). Similarly, IRW increased NAMPT mRNA and protein levels in the liver (2.6-fold, p < 0.01) and muscle tissues (2.3-fold, p < 0.05) of C57BL/6J mice fed with a high-fat diet (HFD). A significantly increased level of circulating NAD+ was also observed following IRW treatment (4.7 fold, p < 0.0001). Dosing of Drosophila melanogaster with IRW elevated both D-NAAM (fly NAMPT) and NAD+ in vivo (p < 0.05). However, IRW treatment did not boost NAMPT levels in SIRT1 KO cells, indicating a possible SIRT1 dependency for the pharmacological effect. Overall, these data indicate that IRW is a novel small peptide booster of the NAMPT pool.

Peptides GWN and GW protect kidney cells against Dasatinib induced mitochondrial injury in a SIRT1 dependent manner

“…These cell lysates were run on SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with primary antibodies according to the recommended concentration(s) by manufacturer. After incubating with the secondary antibodies, protein bands were detected using a Licor Odyssey BioImager (Licor Biosciences, Lincoln, NB) and quantified by densitometry using Image Studio Lite 5.2 software, as described in our recent report ( Bhullar et al, 2021a ).…”

“…First, the mitochondria were extracted from the cells as per our recent report ( Bhullar et al, 2021a ). Next, according to a previous report, DNA extraction was conducted ( Boccellino et al, 2003 ).…”

“…293 T SIRT1 KO cells were prepared using the CRISPR-Cas9 methodology described in our recent report ( Bhullar et al, 2021b ). The oligonucleotide sequences included SIRT1 crRNA: CUGAAUAUACCUCAGCGCCA, SIRT1 Sequencing Primer Fwd: TTTTCACACTTCCCTCCTTCAT, SIRT1 Sequencing Primer Rev: TCCTTGCTCTATCGAGTTCACA.…”

“…One group of small molecules which have gained attention as potent antioxidants and cytoprotective molecules are bioactive peptides ( Bhullar & Wu, 2020 ). Owing to their ability to boost mitochondrial antioxidant enzymes and improve overall metabolic health, they hold a strong potential in the alleviation of dasatinib-induced mitochondrial stress ( Bhullar et al, 2021a , Fan et al, 2021 ). Also, the lack of any significant effect on the oral bioavailability of dasatinib in presence of antioxidant nutraceuticals supports the exploration of detoxifying antioxidant peptides ( Maher, Alzoman, Shehata, & Abanmy, 2018 ).…”

Effects of IQW and IRW on Inflammation and Gut Microbiota in ETEC-Induced Diarrhea

“…Our team focused on adding this active peptide to the host diet, exploring the prevention and treatment of intestinal damage. We explored the impact of colitis by adding IRW and IQW to the diet of a DSS-induced colitis mouse model; research showed that IQW could adjust the amino acid levels in serum and regulate intestinal immune function to relieve inflammation; IQW and IRW could reduce oxidative stress induced by DSS by increasing antioxidant enzyme activity; IQW and IRW achieved this by increasing the diversity of the host's intestinal microorganisms and increasing the probiotic biomass [16,17]. In view of the IQW and IRW effect in the DSS-induced mouse model, we expect IQW and IRW can perform a similar effect in the ETECinduced mouse model.…”