TT virus levels in the plasma of infected individuals with different hepatic and extrahepatic pathology

Pistello, Mauro; Morrica, Antonietta; Maggi, Fabrizio; Vatteroni, Maria Linda; Freer, Giulia; Fornai, Claudia; Casula, F.; Marchi, Santino; Ciccorossi, P.; Rovero, Paolo; Bendinelli, Mauro

doi:10.1002/1096-9071(20000201)63:2<189::aid-jmv1014>3.0.co;2-h

Cited by 53 publications

(23 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was extracted from buffy coat cells by using the QIAamp DNA Blood Mini kit (Qiagen, Milan, Italy). Provirus DNA was quantitated by amplifying 0.3 to 0.6 g of extracted DNA by TM-PCR on the ABI Prism 7700 Sequence Detection System (Applied Biosystems, Monza, Italy), with 900 nM M2-S sense primer (AGACC GCTGCCCTATTTCACT; nucleotide positions 1296 to 1316 and referred to as FIV-Petaluma [59]), 300 nM M2-AS antisense primer (TTCTGGCTGGTGCA AATCTG; nucleotides 1367 to 1386), and 100 nM M2-P probe (TGCCTGTTG TTCTTGAGTTAATCCTATTCCCA; nucleotides 1330 to 1359) and under conditions described elsewhere (52). The standard curve was generated by coamplifying serial 10-fold dilutions (10 2 to 10 7 ) of pGEM-M2 plasmid containing the whole p25 region of FIV-M2.…”

Section: Methodsmentioning

confidence: 99%

AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Failure To Protect and Possible Enhancement of Challenge Infection by Four Cell-Based Vaccines Prepared with Autologous Lymphoblasts

Giannecchini

Isola

Sichi

et al. 2002

J Virol

Self Cite

View full text Add to dashboard Cite

Immunogenicity and protective activity of four cell-based feline immunodeficiency virus (FIV) vaccines prepared with autologous lymphoblasts were investigated. One vaccine was composed of FIV-infected cells that were paraformaldehyde fixed at the peak of viral expression. The other vaccines were attempts to maximize the expression of protective epitopes that might become exposed as a result of virion binding to cells and essentially consisted of cells mildly fixed after saturation of their surface with adsorbed, internally inactivated FIV particles. The levels of FIV-specific lymphoproliferation exhibited by the vaccinees were comparable to the ones previously observed in vaccine-protected cats, but antibodies were largely directed to cell-derived constituents rather than to truly viral epitopes and had very poor FIV-neutralizing activity. Moreover, under one condition of testing, some vaccine sera enhanced FIV replication in vitro. As a further limit, the vaccines proved inefficient at priming animals for anamnestic immune responses. Two months after completion of primary immunization, the animals were challenged with a low dose of homologous ex vivo FIV. Collectively, 8 of 20 vaccinees developed infection versus one of nine animals mock immunized with fixed uninfected autologous lymphoblasts. After a boosting and rechallenge with a higher virus dose, all remaining animals became infected, thus confirming their lack of protection.

show abstract

Section: Methodsmentioning

confidence: 99%

AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Failure To Protect and Possible Enhancement of Challenge Infection by Four Cell-Based Vaccines Prepared with Autologous Lymphoblasts

Giannecchini

Isola

Sichi

et al. 2002

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…In people who have received multiple blood transfusions the virus is almost universally present with more than one subtype in each individual. Table 1 demonstrates the countrywide prevalence of TTV infection in different categories of populations including both healthy persons and patients with various types of diseases [62][63][64][65][66][67][68][69][70][71][72][73][74][75] .…”

Section: Epidemiologymentioning

confidence: 99%

Transfusion transmitted virus: A review on its molecular characteristics and role in medicine

Irshad¹,

Yk²,

Dhar³

2006

WJG

View full text Add to dashboard Cite

The present review gives an updated overview of transfusion transmitted virus (TTV), a novel agent, in relation to its molecular characteristics, epidemiological features, modes of transmission, tissue tropism, pathogenesis, role in various diseases and its eradication from the body. TTV, a DNA virus, is a single stranded, non-enveloped, 3.8 kb long DNA virus with a small and covalently closed circular genome comprising 3852 bases. It was tentatively designated Circinoviridae virus.TTV genome sequence is heterogeneous and reveals the existence of six different genotypes and several subtypes. TTV has been reported to transmit not only via parenteral routes, but also via alternate routes. This virus has been detected in different non-human primates as well. At present, TTV is detected by polymerase chain reaction (PCR) with no other available diagnostic assays. It shows its presence globally and was detected in high percent populations of healthy persons as well as in various disease groups. Initially it was supposed to have strong association with liver disease; however, there is little evidence to show its liver tropism and contribution in causing liver diseases. It shows high prevalence in hemodialysis patients, pointing towards its significance in renal diseases. In addition, TTV is associated with several infectious and non-infectious diseases. Although its exact pathogenesis is not yet clear, TTV virus possibly resides and multiplies in bone marrow cells and peripheral blood mononuclear cells (PBMCs). Recently, attempts have been made to eradicate this virus with interferon treatment. More information is still needed to extricate various mysteries related to TTV.

show abstract

“…The epidemiology and pathogenic potential of TTV is poorly understood. In several studies, however, the viral genome has been detected at comparable prevalence rates in the blood of healthy persons and patients and this led to the hypothesis that TTV might be essentially non-pathogenic in nature [18] . TTV can be transmitted by parenteral route, although its role in causing post-transfusion hepatitis has not been established.…”

Section: Introductionmentioning

confidence: 99%

Torque teno virus: Its prevalence and isotypes in North India

Irshad¹,

Singh²,

Irshad³

et al. 2008

WJG

View full text Add to dashboard Cite

AIM:To investigate the prevalence and genotype distribution of Torque teno virus (TTV) in patients with different liver diseases and chronic renal failure treated at a referral hospital in North India. METHODS: Whereas prevalence of TTV was based on amplification of conserved region of ORF2 of TTV genome, the genotyping of TTV was carried out using restriction fragment length polymorphism (RFLP) procedure on the N22 region of ORF1. RESULTS: TTV-DNA was detected in 137 of 513 (26.7%) patients with liver diseases and 38 of 65 (58.5%) patients with chronic renal failure. TTV was also detected in 27% of healthy controls. The sequence analysis of the PCR product from 10 randomly selected cases failed to show a significant sequence divergence when compared with that of the TRM1 isolate of TTV genotype 1. The results of genotyping in 55 randomly selected patients showed the presence of genotype 1 (G1) in 53 (96.4%) and genotype 2 (G2) in 2 cases (3.6%), respectively. Other genotypes were not identified in this patient subgroup, suggesting that G1 is predominant in this area. The results of genotyping by RFLP were also supported by phylogenetic tree analysis, where G1 was found to be the major genotype. CONCLUSION: These results indicate that TTV is moderately present in Indian patients, with G1 to be the major genotype in North India. The pathogenicity and etiological role of TTV in different diseases is still a question mark and warrant further studies.

show abstract

TT virus levels in the plasma of infected individuals with different hepatic and extrahepatic pathology

Cited by 53 publications

References 37 publications

AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Failure To Protect and Possible Enhancement of Challenge Infection by Four Cell-Based Vaccines Prepared with Autologous Lymphoblasts

AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Failure To Protect and Possible Enhancement of Challenge Infection by Four Cell-Based Vaccines Prepared with Autologous Lymphoblasts

Transfusion transmitted virus: A review on its molecular characteristics and role in medicine

Torque teno virus: Its prevalence and isotypes in North India

Contact Info

Product

Resources

About