Understanding androgen action in adipose tissue

O’Reilly, Michael; House, Philip J.; Tomlinson, Jeremy W.

doi:10.1016/j.jsbmb.2014.04.008

Cited by 132 publications

(90 citation statements)

References 99 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These lipids can be derived from dietary lipoproteins in the circulation, which are hydrolyzed by lipoprotein lipase to free fatty acids, or be released by lipolysis from stores in local adipose tissue depots that comprises a major component of the tumor microenvironment (Ribeiro et al 2012). Androgens are generally viewed to stimulate lipolysis of fatty acids from adipocytes (O'Reilly et al 2014), and have been reported to induce the expression of cell surface proteins that regulate the uptake of lipids from the extracellular microenvironment, including phosphatidic acid phosphatase type 2 (Ulrix et al 1998) and plasma membrane fatty acid binding protein (Pinthus et al 2007). Collectively, these actions of androgens could result in a vicious cycle of fatty acid release from the adipose-rich tumor microenvironment and enhanced uptake by the tumor cells.…”

Section: Androgens Stimulate Lipid Synthesis Uptake and Storagementioning

confidence: 99%

Androgen control of lipid metabolism in prostate cancer: novel insights and future applications

Butler

Centenera

Swinnen

2016

Endocrine-Related Cancer

113

View full text Add to dashboard Cite

One of the most typical hallmarks of prostate cancer cells is their exquisite dependence on androgens, which is the basis of the widely applied androgen deprivation therapy. Among the variety of key cellular processes and functions that are regulated by androgens, lipid metabolism stands out by its complex regulation and its many intricate links with cancer cell biology. Here, we review our current knowledge on the links between androgens and lipid metabolism in prostate cancer, and highlight recent developments and insights into the links between key oncogenic stimuli and altered lipid synthesis and/or uptake that may hold significant potential for biomarker development and provide new vulnerabilities for therapeutic intervention.

show abstract

Section: Androgens Stimulate Lipid Synthesis Uptake and Storagementioning

confidence: 99%

Androgen control of lipid metabolism in prostate cancer: novel insights and future applications

Butler

Centenera

Swinnen

2016

Endocrine-Related Cancer

113

View full text Add to dashboard Cite

show abstract

“…On the other hand, it is possible that androgen levels, in men, contribute to the regulation of body weight. Hypogonadal subjects, who have reduced muscle mass and lower muscular strength, could also have a reduced energy expenditure as described for aging males (10); in addition, androgens could play a role in the regulation of adipose tissue metabolism (11).…”

Section: Introductionmentioning

confidence: 99%

Hypogonadism as an additional indication for bariatric surgery in male morbid obesity?

Samavat

Facchiano

Lucchese

et al. 2014

European Journal of Endocrinology

View full text Add to dashboard Cite

Objective: Male obesity is often associated with reduced levels of circulating total (TT) and calculated free testosterone (cFT), with normal/reduced gonadotropins. Bariatric surgery often improves sex steroid and sex hormone-binding globulin (SHBG) levels. The aim of this study was to assess the effects of bariatric surgery on waist circumference (WC) and BMI, and on TT levels, in morbidly obese men, stratified, according to the gonadal state, in eugonadal and hypogonadal (TT!8 nmol/l) subjects. Design: A cohort of morbidly obese patients (29 with hypogonadism (HG) and 26 without) undergoing bariatric surgery (37, 10, 6, and 2, with Roux-en-Y gastric bypass, laparoscopic adjustable gastric banding, biliopancreatic diversion and gastric sleeve, respectively) was studied at 6 and 12 months from the operation. Methods: Anthropometric parameters (weight, BMI, WC) and sex hormones (gonadotropins, TT, cFT, estradiol (E 2 ), SHBG) were assessed. Results: WC was the only parameter significantly correlated with androgens, but not with E 2 , SHBG, and gonadotropins, at baseline. After surgery, a significant increase in TT, cFT, and SHBG, accompanied by a decrease in E 2 , was evident in the two groups. However, both TT and cFT, but not E 2 , SHBG, and gonadotropin variations, were significantly higher in the hypogonadal group at follow-up, with an overall 93% complete recovery from HG. Reduction in WC, but not BMI, was significantly greater in hypogonadal men (DWCZK29.4G21.6 vs K14.4G17.4 at 12 months, PZ0.047). Conclusions: Recovery from obesity-associated HG is one of the beneficial effects of bariatric surgery in morbidly obese men. The present findings suggest that the gonadal state is a predictor of WC decrease after bariatric surgery.

show abstract

“…Androgens target many organs, including those of the female reproductive pathways (ovaries), male reproductive pathways, bone, the cardiovascular system, the immune system, skin, the kidney, the lungs, fat tissue, and the brain (Usui et al, 2014). Androgens combine with androgen receptors, causing animals to accumulate fat and indirectly regulating growth (O'Reilly et al, 2014). Most importantly, androgens control sexual dimorphism (Pollock et al, 2017).…”

Section: Discussionmentioning

confidence: 99%

“…They perform a great number of functions by combining with the androgen receptor (AR; O'Reilly et al, 2014). As a member of the nuclear receptor superfamily, the AR could regulate downstream target genes and thereby alter various cell functions.…”

Section: Introductionmentioning

confidence: 99%

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Zhao

Wang

et al. 2018

Arch. Anim. Breed.

View full text Add to dashboard Cite

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05).In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

show abstract

Understanding androgen action in adipose tissue

Cited by 132 publications

References 99 publications

Androgen control of lipid metabolism in prostate cancer: novel insights and future applications

Androgen control of lipid metabolism in prostate cancer: novel insights and future applications

Hypogonadism as an additional indication for bariatric surgery in male morbid obesity?

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Contact Info

Product

Resources

About