Undocumented translocations spawn taxonomic inflation in Sri Lankan fire rasboras (Actinopterygii, Cyprinidae)

Abstract

A recent (2013) taxonomic review of the freshwater-fish genus Rasboroides, which is endemic to Sri Lanka, showed it to comprise four species: R. vaterifloris, R. nigromarginatus, R. pallidus and R. rohani. Here, using an integrative-taxonomic analysis of morphometry, meristics and mitochondrial DNA sequences of cytochrome b (cytb) and cytochrome oxidase subunit 1 (coi), we show that R. nigromarginatus is a synonym of R. vaterifloris, and that R. rohani is a synonym of R. pallidus. The creation and recognition of unnecessary taxa (‘taxonomic inflation’) was in this case a result of selective sampling confounded by a disregard of allometry. The population referred to R. rohani in the Walawe river basin represents an undocumented trans-basin translocation of R. pallidus, and a translocation into the Mahaweli river of R. vaterifloris, documented to have occurred ca 1980, in fact involves R. pallidus. A shared haplotype suggests the latter introduction was likely made from the Bentara river basin and not from the Kelani, as claimed. To stabilize the taxonomy of these fishes, the two valid species, R. vaterifloris and R. pallidus, are diagnosed and redescribed, and their distributions delineated. We draw attention to the wasteful diversion of conservation resources to populations resulting from undocumented translocations and to taxa resulting from taxonomic inflation. We argue against translocations except where mandated by a conservation emergency, and even then, only when supported by accurate documentation.

The identity of the Sri Lankan Amblypharyngodon (Teleostei, Cyprinidae)

“…There is, however, only a single species of Amblypharyngodon inhabiting in Sri Lanka, adding weight to the recommendation by Sudasinghe et al (2018b) that conservation plans be predicated on sound taxonomy. Amblypharyngodongrandisquamis is exploited in the fishery and accounts for the highest biomass production among minor indigenous cyprinids in Sri Lanka (Pet et al 1996).…”

“…The protocols for DNA extraction, PCR amplification and PCR product purification for the mitochondrial cytochrome oxidase subunit 1 (COI) and 16s rRNA subunit (16s) follow Sudasinghe et al (2018a), while those for the mitochondrial cytochrome b (cytb) gene follow Sudasinghe et al (2018b).…”

A molecular phylogeny of the freshwater‐fish genusRasbora(Teleostei: Cyprinidae) in Sri Lanka reveals a remarkable diversification—And a cryptic species

“…Two mitochondrial ( cox1 and cytb ) and two nuclear ( rag1 and irbp ) gene markers, were sequenced for the molecular analyses. The methods of DNA extraction, PCR amplification and PCR product purification for cytb and cox1 follow Sudasinghe, Herath, et al (2018) and Sudasinghe, Ranasinghe, Goonatilake, and Meegaskumbura (2018), respectively. The ~1,500 bp of rag1 was amplified using the primer pair RAG1F1 (5′ CTG AGC TGC AGT CAG TAC CAT AAG ATG T 3′) and RAG1R1 (5′ CTG AGT CCT TGT GAG CTT CCA TRA AYT T 3′: (López, Chen, & Ortí, 2004), while the ~900 bp of irbp was amplified using the primer pair, 109F (5′ AACTACTGCTCRCCAGAAAARC 3′) and 1001R (5′ GGAAATGCATAGTTGTCTGCAA 3′): Chen, Miya, Saitoh, and Mayden (2008).…”

“…At the level of species, the first response to this must be to identify those at greatest risk through a process of triage such as that offered by the IUCN Red List (IUCN, 2019). Such assessments are handicapped, however, by a lack of population and distribution data for most species, potentially compounded by taxonomic inflation (e.g., Agarwal et al., 2017; Sudasinghe, Herath, Pethiyagoda, & Meegaskumbura, 2018). In this background, the recognition by Silva et al.…”

Diversity, phylogeny and biogeography of Systomus (Teleostei, Cyprinidae) in Sri Lanka

“…Sri Lanka's ichthyofauna, however, is depauperate in comparison with that of southern India. While some 20 genera of freshwater fishes are endemic to the Western Ghats, for example, only two (the cyprinid Rasboroides and the osphronemid Malpulutta ) are endemic to Sri Lanka (Dahanukar, Raghavan, Ali, Abraham, & Shaji, 2011; Dahanukar, Raut, & Bhat, 2004; Katwate et al, 2020; Sudasinghe, Herath, Pethiyagoda, & Meegaskumbura, 2018). Nevertheless, the island contains around 90 species of freshwater fishes: about half of these belong to Cyprinidae (Goonatilake et al, 2020; Pethiyagoda, 1991), a family which originated in South‐East Asia and dispersed to India after the India–Laurasia collision in the Early Eocene (Chatterjee, Goswami, & Scotese, 2013; Chen, Lavoué, & Mayden, 2013).…”