URP-based DNA Fingerprinting ofBipolaris sorokinianaIsolates Causing Spot Blotch of Wheat

Abstract

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPsÕ) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5¢GTGTGCGATCAGTTGCTGGG3¢) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Assessing genetic diversity in the web blight pathogen Thanatephorus cucumeris (anamorph = Rhizoctonia solani) subgroups AG-1-IE and AG-1-IF with molecular markers

“…Most of the studies on population genetics of R. solani or other plant pathogens using dominant markers such as RAPD, URP, AFLP or ISSR have reported that geographic location or host specificity or both had an effect on population structure (Aggarwal et al 2010;Duncan et al 1993;Jana et al 2005;Stodart et al 2007). Because of the limitations of dominant markers, these studies are difficult to compare with other studies where co-dominant markers (microsatellites) were used.…”

“…Based on the degree of polymorphism indicated by the percent of polymorphic loci generated and Shannon's index, URP2R was more suitable for studying genetic diversity in populations of both subgroups. In general, both URP and ISSR marker systems have been useful for evaluating variation in fungal populations (Aggarwal et al 2010;Jana et al 2005;Kiyosi et al 2005;Sharma et al 2005;Stodart et al 2007). The UPGMA dendrogram showed two main clusters separating subgroups.…”

Genetic variability of Bipolaris sorokiniana isolates using URP-PCR

“…The same 12 URP-PCR primers as used in the present study were used to characterize of B. sorokiniana from India; only two of these primers failed to produce amplification products and one primer produced monomorphic fragments that could be used as molecular markers (Aggarwal et al, 2010). Here, we observed that isolates from Brazil were more efficiently amplified with URP primers and different behavior was observed in isolates from other countries.…”

“…using URP-PCR. In contrast, in a study of B. sorokiniana isolates from India, Aggarwal et al (2010) observed a polymorphic profile among the isolates and only two URP-PCR primers were able to amplify monomorphic bands in this phytopathogen. The aim of the present study was to assess the genetic diversity of monoconidial isolates of B. sorokiniana using URP-PCR assays.…”

“…In contrast, Aggarwal et al (2010) correlated URP-PCR data with the geographic origin of the isolates. In our studies, URP primers were also shown to be conserved in fungi, enabling detection of intraspecific variation among sets of single-spore isolates derived from the same polysporic strain.…”