The present experiment was designed to study the 2.45 GHz low-level microwave (MW) irradiation-induced stress response and its effect on implantation or pregnancy in female mice. Twelve-week-old mice were exposed to MW radiation (continuous wave for 2 h/day for 45 days, frequency 2.45 GHz, power density=0.033549 mW/cm(2), and specific absorption rate=0.023023 W/kg). At the end of a total of 45 days of exposure, mice were sacrificed, implantation sites were monitored, blood was processed to study stress parameters (hemoglobin, RBC and WBC count, and neutrophil/lymphocyte (N/L) ratio), the brain was processed for comet assay, and plasma was used for nitric oxide (NO), progesterone and estradiol estimation. Reactive oxygen species (ROS) and the activities of ROS-scavenging enzymes- superoxide dismutase, catalase, and glutathione peroxidase-were determined in the liver, kidney and ovary. We observed that implantation sites were affected significantly in MW-irradiated mice as compared to control. Further, in addition to a significant increase in ROS, hemoglobin (p<0.001), RBC and WBC counts (p<0.001), N/L ratio (p<0.01), DNA damage (p<0.001) in brain cells, and plasma estradiol concentration (p<0.05), a significant decrease was observed in NO level (p<0.05) and antioxidant enzyme activities of MW-exposed mice. Our findings led us to conclude that a low level of MW irradiation-induced oxidative stress not only suppresses implantation, but it may also lead to deformity of the embryo in case pregnancy continues. We also suggest that MW radiation-induced oxidative stress by increasing ROS production in the body may lead to DNA strand breakage in the brain cells and implantation failure/resorption or abnormal pregnancy in mice.

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPsÕ) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5¢GTGTGCGATCAGTTGCTGGG3¢) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

No abstract

We hypothesized that very low doses of gamma-rays have a genotoxic effect as measured by DNA single-strand breaks (ssbs). To test our hypothesis we used a newly developed alkaline microgel electrophoretic technique to quantitate DNA ssbs in freshly isolated human lymphocytes. An enhanced sensitivity to detect low levels of DNA damage was made possible by this method due to an additional step of DNA precipitation by ethanol in agarose microgels. We exposed lymphocytes from three subjects for 1 h at 4 degrees C to 740 MBq of technetium 99-m at a distance of 20 cm (0.25 mGy), 10 cm (1.02 mGy), and 5 cm (4.08 mGy) from the source vial. Doses of 1.02 and 4.08 mGy induced a significant dose-dependent increase in DNA ssbs in human lymphocytes from three subjects, each examined on three different days.

No abstract