Ursodeoxycholic acid ameliorates diabetic retinopathy via reducing retinal inflammation and reversing the breakdown of blood-retinal barrier

Ouyang, Hao; Mei, Xiyu; Zhang, Tianyu; Lü, Bin; Ji, Lili

doi:10.1016/j.ejphar.2018.09.027

Cited by 36 publications

(41 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Our results showed that UDCA reduced the mRNA expression of VEGF in the APB5-induced retina. The following may be responsible for this desirable effect: UDCA attenuated vascular destruction based on our findings and restored BRB breakdown by abrogating the NFκB-mediated inflammatory signaling pathway 20 , which inhibited the progression of retinal ischemia and therefore suppressed VEGF expression; UDCA suppressed macrophage-derived VEGF according to our result of immunostaining results. Moreover, in terms of the action mechanism of UDCA, a previous study showed that tauroursodeoxycholic acid (formed by the conjugation of UDCA with taurine) suppressed the increased expression of VEGF in high glucose-induced retinal microvascular endothelial cells 28 , demonstrating that UDCA also functions targeting the vascular endothelium.…”

Section: Discussionsupporting

confidence: 52%

“…cDNA was synthesized according to the manufacturer's instructions. RT-PCR was performed using kits, and the relative expression of target genes was normalized to GAPDH, analyzed by the 2 -ΔΔCt method and given as a ratio compared with the control 20 . The following primers were used for the analyses: VEGF forward (GCCAGCACATAGGAGAGATGAGC), VEGF reverse (CAAGGCTCACAGTGATTTTCTGG); ICAM-1 forward (GGCACCCAGCAGAAGTTGTT), ICAM-1 reverse (CCTCAGTCACCTCTACCAAG); IP-10 forward (CAGTGAGAATGAGGGCCATAGG), IP-10 reverse (CTCAACACGTGGGCAGGAT); MCP-1 forward (ATTGGGATCATCTTGCTGGT), MCP-1 reverse (CCTGCTGTTCACAGTTGCC); TNF-α forward (CATGAGCACAGAAAGCATGATCCG), and TNF-α reverse (AAGCAGGAATGAGAAGAGGCTGAG).…”

Section: Morphological Analyses: Retinal Vessel Integrity Fluoresceimentioning

confidence: 99%

“…streptozocin (STZ)-induced diabetic mice showed that UDCA attenuates endoplasmic reticulum stress-related retinal PC depletion 21 and reduction the retinal expression of VEGF, restoration the BRB after breakdown based on a fluorescein permeation assay 20,21 .…”

mentioning

confidence: 99%

See 2 more Smart Citations

Ursodeoxycholic Acid Attenuates the Retinal Vascular Abnormalities in Anti-PDGFR-β Antibody-Induced Pericyte Depletion Mouse Models

Shiraya

Araki

Ueta

et al. 2020

Sci Rep

View full text Add to dashboard Cite

As a clinical manifestations of diabetic retinopathy (DR), pericytes (pcs) loss from the capillary walls is thought to be an initial pathological change responsible for the breakdown of the blood-retinal barrier (BRB). This study was performed to investigate the effects of ursodeoxycholic acid (UDCA) in pc depletion mice by injection of an antibody against platelet-derived growth factor reception-β (pDGfR-β clone APB5). To assess the integrity of the retinal vessels, their density, diameters, vessel branching points, and number of acellular capillaries were evaluated. While all types of retinal vessels became enlarged in APB5-induced mice, treatment with UDCA rescued the vasculature; the vessel density, diameter of the veins and capillaries, and vessel branching points were significantly lower in mice treated with UDCA. Although APB5-induced mice displayed progressive exacerbation of retinal edema, whole retinal thickness upon treatment with UDCA was significantly decreased. Additionally, UDCA reduced the expression of F4/80 + macrophages in the APB5-induced retina according to immunofluorescent labeling. UDCA also reduced the increased expression of angiogenic factors and inflammatory mediators (vascular endothelial growth factor, intercellular adhesion molecule-1, and monocyte chemotactic protein-1). These findings suggest that UDCA can be used to prevent the progression of and treat DR. Diabetes and its related complications, including retinopathy, have a great social and economic burden worldwide 1,2. The World Health Organization has suggested that diabetic retinopathy (DR) is responsible for 15-17% of total blindness cases in the United States and Europe 1,3-5. Pericytes (PC) not only provide mechanical support, but also maintain vessel wall integrity by interacting with endothelial cells (EC) via secretory signals and direct cell-to-cell contact 6. As an early clinical manifestation of DR, PC depletion from the capillary wall is considered an early pathological change that causes the blood-retinal barrier (BRB) to collapse and subsequent vascular hyperpermeability 7. Furthermore, PC depletion results in vascular abnormalities along with upregulation of angiogenic factors and inflammatory cytokines 8,9. In cases of more advanced DR, vascular occlusion induces retinal hypo-perfusion and hypoxia, resulting in abnormal angiogenesis that directly causes blindness due to vitreous hemorrhage and tractional retinal detachment 10. In recent years, intravitreal injections of anti-vascular endothelial growth factor (VEGF) agents have been effectively used to treat diabetic macular edema 11-13 and have also empirically indicated the involvement of the VEGF signaling and inflammation in BRB breakdown in DR 14. However, frequent injections are burdensome for patients and physicians, and are associated with a very high cost to the healthcare system. Preventative medicine of DR with a safe and low-burden treatment for patients that requires investigation. Ursodeoxycholic acid (UDCA), a product of the hydrolysis of taurour...

show abstract

Section: Discussionsupporting

confidence: 52%

Section: Morphological Analyses: Retinal Vessel Integrity Fluoresceimentioning

confidence: 99%

See 1 more Smart Citation

Ursodeoxycholic Acid Attenuates the Retinal Vascular Abnormalities in Anti-PDGFR-β Antibody-Induced Pericyte Depletion Mouse Models

Shiraya

Araki

Ueta

et al. 2020

Sci Rep

View full text Add to dashboard Cite

show abstract

“…After a week of adaption, mice were randomly divided into four groups (n = 10) for the treatment of 5% CMCNa (Control group), As(III) group (5 mg/kg), As(III)+ UDCA group (30 mg/kg), and UDCA alone group via intragastric administration, respectively. The doses of As(III) (Li et al, 2017;Zuo et al, 2017) and UDCA (Mroz et al, 2018;Ouyang et al, 2018;Zhang et al, 2018) were referred to the basis of previously published literature. Mice in the Control groups were administered equal volumes of 5% CMCNa.…”

Section: Animals and Treatmentsmentioning

confidence: 99%

Ursodeoxycholic Acid Protects Against Arsenic Induced Hepatotoxicity by the Nrf2 Signaling Pathway

Zhang

et al. 2020

Front. Pharmacol.

View full text Add to dashboard Cite

Arsenic is ubiquitous toxic metalloid responsible for many human diseases all over the world. Contrastingly, Ursodeoxycholic acid (UDCA) has been suggested as efficient antioxidant in various liver diseases. However, there are no reports of the effects of UDCA on arsenious acid [As(III)]-induced hepatotoxicity. The objective of this study is to elucidate the protective actions of UDCA on As(III)-induced hepatotoxicity and explore its controlling role in biomolecular mechanisms in vivo and in vitro. The remarkable liver damage induced by As(III) was ameliorated by treatment with UDCA, as reflected by reduced histopathological changes of liver and elevation of serum AST, ALT levels. UDCA play a critical role in stabilization of cellular membrane potential, inhibition of apoptosis and LDH leakage in LO2 cells. Meanwhile, the activities of SOD, CAT and GSH-Px and the level of TSH, GSH were enhanced with UDCA administration, while the accumulations of intracellular ROS, MDA and rate of GSSG/GSH were decreased in vivo and in vitro. Further study disclosed that UDCA significantly inhibited As(III)-induced apoptosis through increasing the expression of Bcl-2 and decreasing the expression of Bax, p53, Cyt C, Cleaved caspase-3 and 9. Moreover, UDCA promoted the expression of nuclear Nrf2, HO-1, and NQO1, although arsenic regulated nuclear translocation of Nrf2 positively. When Nrf2 was silenced, the protective effect of UDCA was abolished. Collectively, the results of this study showed that UDCA protects hepatocytes antagonize As(III)-induced cytotoxicity, and its mechanism may be related to activation of Nrf2 signaling.

show abstract

“…Herein, we have investigated the effects of the secondary BA, UDCA, and its glycine and taurine derivatives, GUDCA and TUDCA, in halting ROP-like features in mice subjected to OIR. Besides their well-known role as regulators of hepatic cholesterol homeostasis, these important bioactive molecules have recently gained attention for the treatment of a number of ocular diseases-in particular, retinal ischemic pathologies such as diabetic retinopathy [39,40]. To date, little is known on the effects of these highly biological active compounds for the treatment of pediatric eye diseases such as ROP.…”

Section: Discussionmentioning

confidence: 99%

Ursodeoxycholic Acid Halts Pathological Neovascularization in a Mouse Model of Oxygen-Induced Retinopathy

Thounaojam

Jadeja

Rajpurohit

et al. 2020

JCM

View full text Add to dashboard Cite

Retinopathy of prematurity (ROP) is the leading cause of blindness in infants. We have investigated the efficacy of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine and glycine conjugated derivatives tauroursodeoxycholic acid (TUDCA) and glycoursodeoxycholic acid (GUDCA) in preventing retinal neovascularization (RNV) in an experimental model of ROP. Seven-day-old mice pups (P7) were subjected to oxygen-induced retinopathy (OIR) and were treated with bile acids for various durations. Analysis of retinal vascular growth and distribution revealed that UDCA treatment (50 mg/kg, P7–P17) of OIR mice decreased the extension of neovascular and avascular areas, whereas treatments with TUDCA and GUDCA showed no changes. UDCA also prevented reactive gliosis, preserved ganglion cell survival, and ameliorated OIR-induced blood retinal barrier dysfunction. These effects were associated with decreased levels of oxidative stress markers, inflammatory cytokines, and normalization of the VEGF–STAT3 signaling axis. Furthermore, in vitro tube formation and permeability assays confirmed UDCA inhibitory activity toward VEGF-induced pro-angiogenic and pro-permeability effects on human retinal microvascular endothelial cells. Collectively, our results suggest that UDCA could represent a new effective therapy for ROP.

show abstract

Ursodeoxycholic acid ameliorates diabetic retinopathy via reducing retinal inflammation and reversing the breakdown of blood-retinal barrier

Cited by 36 publications

References 31 publications

Ursodeoxycholic Acid Attenuates the Retinal Vascular Abnormalities in Anti-PDGFR-β Antibody-Induced Pericyte Depletion Mouse Models

Ursodeoxycholic Acid Attenuates the Retinal Vascular Abnormalities in Anti-PDGFR-β Antibody-Induced Pericyte Depletion Mouse Models

Ursodeoxycholic Acid Protects Against Arsenic Induced Hepatotoxicity by the Nrf2 Signaling Pathway

Ursodeoxycholic Acid Halts Pathological Neovascularization in a Mouse Model of Oxygen-Induced Retinopathy

Contact Info

Product

Resources

About