Use of polymerase chain reaction-amplified Helicobacter pylori urease structural genes for differentiation of isolates

Abstract

Helicobacter pylon has been demonstrated as an etiologic agent of human gastritis and peptic ulcer formation. However, there is no straightforward basis to distinguish different isolates. We used the polymerase chain reaction (PCR) to amplify the urease structural subunit genes, ureA and ureB, which, when digested with appropriate restriction endonucleases, allow the differentiation of patterns on agarose gels. PCR amplification was possible with DNA rapidly extracted from H. pylon by alkaline lysis and phenol-chloroform. The 2.4-kb

Intra‐strain variation in expression of lipopolysaccharide by Helicobacter pylori

“…and 5?-ACTTT ATTGGCTGGT-3? (Foxall et al 1992). A 3071 bp fragment of the vacuolating cytotoxin gene (vacA) was amplified using the primers 5?-CCGCCTTTTTTACAACCGT GATC-3?…”

Heterogeneity of Protein Profiles of Helicobacter pylori Isolated from Individual Patients

“…PCR-RFLP analysis of H. pylori isolates [20][21][22] was performed with slight modification. DNA of H. pylori isolates was obtained by incubation with 5 mM EDTA, 1% SDS, proteinase K (100 g/ml) in Tris-EDTA (TE) buffer (pH 7.4) for 60 min at 37 Њ C, extraction with phenol-chloroform and ethanol precipitation.…”

“…DNA of H. pylori isolates was obtained by incubation with 5 mM EDTA, 1% SDS, proteinase K (100 g/ml) in Tris-EDTA (TE) buffer (pH 7.4) for 60 min at 37 Њ C, extraction with phenol-chloroform and ethanol precipitation. The oligonucleotides used as PCR primers were 5 Ј AGGAGAATGAGATGA3 Ј and 5 Ј ACTTTATTGGCTGGT3 Ј for ureA-ureB [20], and 5 Ј TGGGACTGATGGCGTGAGGG3 Ј and 5 Ј ATCATGACATCAGCGAAGTTAAAAATGG3 Ј for ureC-ureD [23]. PCR amplification was carried out in 50 l, using extracted DNA, 2.5 U Taq DNA polymerase (TaKaRa Taq TM , Takara Shuzo, Shiga, Japan), standard 10 ϫ PCR buffer, 2.5 mM d NTP mixture (Takara Shuzo), 10% DMSO and about 200 pmol of each primer (Takara Shuzo).…”

Identification of mixed genotypes in Helicobacter pylori from gastric biopsy tissue by analysis or urease gene polymorphisms

“…Oligonucleotide primers were synthesized commercially (Pharmacia Biosystems, Milton Keynes, UK). The primers for the amplification of a urease A and urease B gene internal 2.41-kb fragment had the sequences 5'-AGGAGAATGA-GATGA-3' (forward) and 5'-ACTTTATTG-GCTGGT-3' (reverse), as described by Foxall et al [12]. After dilution in TE to a concentration of 10 /~M, aliquots of each primer were stored at -20oc.…”