Use of Pulsed-Field Gel Electrophoresis, Enterobacterial Repetitive Intergenic Consensus Typing, and Automated Ribotyping To Assess Genomic Variability among Strains of Nontypeable Haemophilus influenzae

Abstract

We compared 75 nontypeable (NT) Haemophilus influenzae isolates by pulsed-field gel electrophoresis (PFGE), enterobacterial repetitive intergenic consensus (ERIC)-PCR, and automated ribotyping. PFGE was the most discriminatory of the techniques. ERIC-PCR provides a useful screen but should not replace other techniques as the sole method to group NT H. influenzae strains.In distinguishing strain similarities and differences among nontypeable (NT) Haemophilus influenzae isolates, phenotypic typing methods such as outer membrane protein analysis, biotyping, and lipooligosaccharide analysis are gradually being replaced by genotypic techniques (6,8,15). Pulsed-field gel electrophoresis (PFGE) analysis compares the patterns of genomic DNA digested with a rare cutting restriction enzyme and is considered to be the "gold standard" for typing NT H. influenzae isolates. Enterobacterial repetitive intergenic consensus (ERIC) sequences are conserved regions of DNA dispersed throughout the genomes of gram-negative, enteric bacteria (7). The distribution of ERIC sequences varies between strains, and ERIC-specific primers have been used to produce genetic fingerprints of bacterial genomes (14), including NT H. influenzae strains (13). An automated technique based on traditional ribotyping has also recently been used for the epidemiologic analysis of H. influenzae strains (16).With the exception of total genome sequencing, genotypic methods are not definitive in identifying all possible strain differences. Rather, these methods group strains according to the presence of common restriction sites (PFGE and ribotyping) or the presence of PCR products of uniform size (ERIC-PCR). The choice of typing method depends on factors including time, cost, reproducibility, and the ability of a method to correctly distinguish between clonal and nonclonal isolates. In order to assess these typing techniques for studies of NT H. influenzae, we compared 75 strains by each of the three methods.Bacterial strains used in this study included H. influenzae strain Rd (1), 44 middle ear isolates, 28 nasopharyngeal or throat isolates, and 2 Brazilian purpuric fever strains. Strains were collected from sites in Minnesota (3), Ann Arbor, Michigan (11), Battle Creek, Michigan (11), and Bardstown, Kentucky (5), between 1980 and 1999. PFGE was performed on NT H. influenzae genomic DNA digested with SmaI (Gibco-BRL) as previously described (11). A 1-l aliquot of crude genomic NT H. influenzae DNA was used for ERIC-PCR in a 50-l reaction volume containing 25 pmol of ERIC1 primer (5ЈCACTTAGGGGTCCTCGAATGT A3Ј), 5mM MgCl 2 , 2 U of Platinum Taq polymerase (Gibco-BRL), and a 0.2 mM concentration of each deoxynucleoside triphosphate. PCR was initiated with a 2-min incubation at 94°C, followed by 35 cycles of 90°C for 30 s, 60°C for 1 min, and 72°C for 4.5 min. To check for reproducibility, four NT H. influenzae strains were typed using ERIC-PCR on three separate occasions. Ribotyping was performed using the RiboPrinter Microbial Characterization System from Qualico...

Hypermutable Haemophilus influenzae with mutations in mutS are found in cystic fibrosis sputum

“…One mutator was an invasive blood isolate (C2202) and one was a conjunctivitis isolate (C2475). Pettigrew et al, 2002;van Belkum et al, 1994). We found PCR using only one primer per reaction provided more distinctive and reproducible amplification profiles.…”

Partial Analysis of the Genomes of Two Nontypeable Haemophilus influenzae Otitis Media Isolates

“…With respect to NTHI, most studies have focused on differences in the sequence of single genes or small gene clusters or the presence or absence of specific genes, although Williams et al identified and characterized a bacteriophage that was present in an invasive nontypeable isolate (50). From an epidemiologic perspective, Pettigrew et al employed pulse field gels, ribotyping and enterobacterial repetitive intergenic consensus typing to examine strain differences among NTHI (42). Similarly, Meats et al have employed multilocus sequence typing for epidemiologic characterization of isolates (36).…”

Molecular Characterization of Haemophilus ducreyi Isolates from Different Geographical Locations

“…This observation indicates that both RAPD and PFGE techniques can be used to characterize the diversity of H. ducreyi strains. However, it should be mentioned that RAPD is more rapid and accessible in resourcepoor countries, such as those in Africa, than other molecular methods that require expensive equipment (12,19,23).…”

“…An alternative genotyping method, pulsed-field gel electrophoresis (PFGE), which is used in numerous and diverse applications, is considered to be the most discriminatory technique and the "gold standard" in identifying different strains of, for example, Haemophilus influenzae (19).…”