Haemophilus influenzae is an important cause of respiratory infections, including acute otitis media, sinusitis, and chronic bronchitis, which are preceded by asymptomatic H. influenzae colonization of the human pharynx. The aim of this study was to describe the dynamics of pharyngeal colonization by H. influenzae and an intimately related species, Haemophilus haemolyticus, in healthy adults. Throat specimens from four healthy adult carriers were screened for Haemophilus species; 860 isolates were identified as H. influenzae or H. haemolyticus based on the porphyrin test and on dependence on hemin and NAD for growth. Based on tests for hemolysis, for the presence of the 7F3 epitope of the P6 protein, and for the presence of iga in 412 of the isolates, 346 (84%) were H. influenzae, 47 (11%) were H. haemolyticus, 18 (4%) were nonhemolytic H. haemolyticus, and 1 was a variant strain. Carriers A and B were predominantly colonized with nontypeable H. influenzae, carrier C predominantly with b ؊ H. influenzae mutants, and carrier D with H. haemolyticus. A total of 358 H. influenzae and H. haemolyticus isolates were genotyped by pulsed-field gel electrophoresis (PFGE) following SmaI or EagI digestion of their DNA, and the carriers displayed the following: carrier A had 11 unique PFGE genotypes, carrier B had 15, carrier C had 7, and carrier D had 10. Thus, adult H. influenzae and H. haemolyticus carriers are colonized with multiple unique genotypes, the colonizing strains exhibit genetic diversity, and we observed day-to-day and week-to-week variability of the genotypes. These results appear to reflect both evolutionary processes that occur among H. influenzae isolates during asymptomatic pharyngeal carriage and sample-to-sample collection bias from a large, variable population of colonizing bacteria.Haemophilus species constitute approximately 10% of the total bacterial flora in the human upper respiratory tract (27). Haemophilus influenzae is an opportunistic pathogen in humans that asymptomatically colonizes the pharyngeal mucosa and occasionally the genital mucosa. The rate of carriage of H. influenzae increases from infancy (about 20% in the first year of life) to early childhood (Ͼ50% in children 5 to 6 years old), and H. influenzae is recoverable from the upper airways of 20 to 80% of healthy children (2,15,22,32).Colonization of the human respiratory mucosal surface represents a dynamic process in which bacteria are acquired, replaced, and reacquired many times in a lifetime. Past studies have demonstrated that H. influenzae colonization of the pharynx is characterized by rapid bacterial turnover (9, 12, 50, 58) and carriage of multiple strains at any one time (18,37,43,52,58). Previous studies have demonstrated a 62% week-to-week turnover rate of H. influenzae isolated from healthy children attending day care; 37 to 43% of throat cultures contained two or more genetically distinct strains (range, zero to five) (14,56).In addition to living as a commensal in the respiratory tract, H. influenzae may also cause s...

No abstract

We compared 75 nontypeable (NT) Haemophilus influenzae isolates by pulsed-field gel electrophoresis (PFGE), enterobacterial repetitive intergenic consensus (ERIC)-PCR, and automated ribotyping. PFGE was the most discriminatory of the techniques. ERIC-PCR provides a useful screen but should not replace other techniques as the sole method to group NT H. influenzae strains.In distinguishing strain similarities and differences among nontypeable (NT) Haemophilus influenzae isolates, phenotypic typing methods such as outer membrane protein analysis, biotyping, and lipooligosaccharide analysis are gradually being replaced by genotypic techniques (6,8,15). Pulsed-field gel electrophoresis (PFGE) analysis compares the patterns of genomic DNA digested with a rare cutting restriction enzyme and is considered to be the "gold standard" for typing NT H. influenzae isolates. Enterobacterial repetitive intergenic consensus (ERIC) sequences are conserved regions of DNA dispersed throughout the genomes of gram-negative, enteric bacteria (7). The distribution of ERIC sequences varies between strains, and ERIC-specific primers have been used to produce genetic fingerprints of bacterial genomes (14), including NT H. influenzae strains (13). An automated technique based on traditional ribotyping has also recently been used for the epidemiologic analysis of H. influenzae strains (16).With the exception of total genome sequencing, genotypic methods are not definitive in identifying all possible strain differences. Rather, these methods group strains according to the presence of common restriction sites (PFGE and ribotyping) or the presence of PCR products of uniform size (ERIC-PCR). The choice of typing method depends on factors including time, cost, reproducibility, and the ability of a method to correctly distinguish between clonal and nonclonal isolates. In order to assess these typing techniques for studies of NT H. influenzae, we compared 75 strains by each of the three methods.Bacterial strains used in this study included H. influenzae strain Rd (1), 44 middle ear isolates, 28 nasopharyngeal or throat isolates, and 2 Brazilian purpuric fever strains. Strains were collected from sites in Minnesota (3), Ann Arbor, Michigan (11), Battle Creek, Michigan (11), and Bardstown, Kentucky (5), between 1980 and 1999. PFGE was performed on NT H. influenzae genomic DNA digested with SmaI (Gibco-BRL) as previously described (11). A 1-l aliquot of crude genomic NT H. influenzae DNA was used for ERIC-PCR in a 50-l reaction volume containing 25 pmol of ERIC1 primer (5ЈCACTTAGGGGTCCTCGAATGT A3Ј), 5mM MgCl 2 , 2 U of Platinum Taq polymerase (Gibco-BRL), and a 0.2 mM concentration of each deoxynucleoside triphosphate. PCR was initiated with a 2-min incubation at 94°C, followed by 35 cycles of 90°C for 30 s, 60°C for 1 min, and 72°C for 4.5 min. To check for reproducibility, four NT H. influenzae strains were typed using ERIC-PCR on three separate occasions. Ribotyping was performed using the RiboPrinter Microbial Characterization System from Qualico...

No abstract

No abstract