Utilising polymorphisms to achieve allele-specific genome editing in zebrafish

Abstract

The advent of genome editing has significantly altered genetic research, including research using the zebrafish model. To better understand the selectivity of the commonly used CRISPR/Cas9 system, we investigated single base pair mismatches in target sites and examined how they affect genome editing in the zebrafish model. Using two different zebrafish strains that have been deep sequenced, CRISPR/Cas9 target sites containing polymorphisms between the two strains were identified. These strains were crossed (creating heterozygotes at polymorphic sites) and CRISPR/Cas9 complexes that perfectly complement one strain injected. Sequencing of targeted sites showed biased, allele-specific editing for the perfectly complementary sequence in the majority of cases (14/19). To test utility, we examined whether phenotypes generated by F0 injection could be internally controlled with such polymorphisms. Targeting of genes bmp7a and chordin showed reduction in the frequency of phenotypes in injected ‘heterozygotes’ compared with injecting the strain with perfect complementarity. Next, injecting CRISPR/Cas9 complexes targeting two separate sites created deletions, but deletions were biased to selected chromosomes when one CRISPR/Cas9 target contained a polymorphism. Finally, integration of loxP sequences occurred preferentially in alleles with perfect complementarity. These experiments demonstrate that single nucleotide polymorphisms (SNPs) present throughout the genome can be utilised to increase the efficiency of in cis genome editing using CRISPR/Cas9 in the zebrafish model.

Allele-specific genome editing of imprinting genes by preferentially targeting non-methylated loci using Staphylococcus aureus Cas9 (SaCas9)

“…The methods of allele-specific targeting by SNP-derived PAM or sgRNAs [12][13][14][15] are only appropriate for SNP containing targets. Our method for allele-specific targeting is also limited for allelemethylated genes, although the choice for sgRNAs is less restricted.…”

“…Some allele-specific diseases, such as imprinting disorders and heterozygous single-nucleotide polymorphism (SNP)-caused diseases [11], raise novel requirements for allele-specific genome editing. In recent years, scientists have successfully achieved allele-specific targeting by SNP-derived PAM or sgRNAs in mice, rats, zebrafish, and human induced pluripotent stem cells (iPSCs) to correct disease-related mutations [12][13][14][15]. In contrast, allelespecific editing of imprinting genes with a differential DNA methylation status at two alleles has not been reported because of the lack of appropriate strategies and tools.…”

Myosin Vb is required for correct trafficking of N‐cadherin and cardiac chamber ballooning

“…For sequencing, primer sequences used were: Fw 5′‐CAGCCCCAATCTTCACTACCA and Rev 5′‐ATTTTGCCACTTATGCATTAAACAA. CRISPR gRNA was synthesized and injected as previously described (Capon et al, ) and HRMA to detect editing was performed as previously described (Dahlem et al, ), using primer sequences: myo5b Fw 5′‐GAACGACACTCATCTGCATCAT and Rev 5′‐CAGTCAAACAGATGGGCATAGA. Generation of the Tg(myl7:Cherry‐Caax) line performed by injecting 1 nl of 25 ng/μl purified plasmid DNA (constructs described in (Uribe et al, )) into one‐cell stage embryos together with tol2 transposase mRNA (25 ng/μl).…”

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume

“…TALEN monomers (Table S2) for nppa were generated using the golden gate kit (Cermak et al, 2011), cloned into the pCS2TAL3RR and pCS2TAL3DD backbones, and transcribed as previously described (Dahlem et al, 2012). CRISPR gDNA (Table S2) and co-injection with cas9 mRNA for targeting nppb was performed as described (Capon et al, 2017). Fish were screened by high-resolution melt analysis (HRMA) using a Viia7 Real-Time PCR System (Applied Biosystems) and F1 embryos carrying a 4 bp deletion and 10 bp insertion for nppa and nppb, respectively, were outcrossed to the wild-type strain to generate an F2 population.…”