Validation of housekeeping gene and impact on normalized gene expression in clear cell Renal Cell Carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression

Abstract

BackgroundYBX3/ZONAB/CSDA is an epithelial-specific transcription factor acting in the density-based switch between proliferation and differentiation. Our laboratory reported overexpression of YBX3 in clear cell renal cell arcinoma (ccRCC), as part of a wide study of YBX3 regulation in vitro and in vivo. The preliminary data was limited to 5 cases, of which only 3 could be compared to paired normal tissue, and beta-Actin was used as sole reference to normalize gene expression. We thus decided to re-evaluate YBX3 expression by real-time-PCR in a larger panel of ccRCC samples, and their paired healthy tissue, with special attention on experimental biases such as inter-individual variations, primer specificity, and reference gene for normalization.ResultsGene expression was measured by RT-qPCR in 16 ccRCC samples, each compared to corresponding healthy tissue to minimize inter-individual variations. Eight potential housekeeping genes were evaluated for expression level and stability among the 16-paired samples. Among tested housekeeping genes, PPIA and RPS13, especially in combination, proved best suitable to normalize gene expression in ccRCC tissues as compared to classical reference genes such as beta-Actin, GAPDH, 18S or B2M. Using this pair as reference, YBX3 expression level among a collection of 16 ccRCC tumors was not significantly increased as compared to normal adjacent tissues. However, stratification according to Fuhrman grade disclosed higher YBX3 expression levels in low-grade tumors and lower in high-grade tumors. Immunoperoxidase confirmed homogeneous nuclear staining for YBX3 in low-grade but revealed nuclear heterogeneity in high-grade tumors.ConclusionsThis paper underlines that special attention to reference gene products in the design of real-time PCR analysis of tumoral tissue is crucial to avoid misleading conclusions.Furthermore, we found that global YBX3/ZONAB/CSDA mRNA expression level may be considered within a “signature” of RCC grading.

Spermatozoal cell death-inducing DNA fragmentation factor-α-like effector A (CIDEA) gene expression and DNA fragmentation in infertile men with metabolic syndrome and normal seminogram

“…Primers of CIDEA for real time RT-PCR according to Yu et al were used [23]: CIDEA; Forward: CATGTATGAGATGTACTCCGTGTC, Reverse: GAGTAGGACAGGAACCGCAG (Gene Bank number NM_001279.3) (PCR product: 90 bp); for β-actin, used as internal control, they were 5′-AGGCCAACCGCGAGAAGATGACC-3′ (forward) and 5′-GAAGTCCAGGGCGACGTAGCAC-3′ (reverse); β-actin PCR product: 332 bp) (Gene Bank-Actin beta [NM_001101.3]) [24]. The gene-specific primers were purchased from Oligo™ Macrogen.…”

Validation of RPS13 as a reference gene for absolute quantification of SIV RNA in tissue of rhesus macaques

“…RPS13 mRNA has been described as a medium abundance reference gene whose expression is tightly regulated via multiple redundant mechanisms (Jacob et al, 2013; Malygin et al, 2007; Zhang et al, 2015). Based on this property, several studies have validated and utilized RPS13 mRNA as a reference gene in relative gene expression studies, especially in oncology research (de Jonge et al, 2007; Dupasquier et al, 2014; Jacob et al, 2013; Rentoft et al, 2010; Zhang et al, 2015). …”

Thyroid follicle development requires Smad1/Smad5- and endothelial-dependent basement membrane assembly

“…Primer sequences are described in Table S3. Actb and Rpl27 were used as reference genes and relative changes in the target gene to reference gene mRNA ratio were determined by transformation of threshold cycles to absolute mRNA numbers (Dupasquier et al, 2014) or using the ΔΔCt method.…”