Validation of real-time reverse transcription polymerase chain reaction to detect virus titer and thermostability of Newcastle disease live virus vaccine

Abstract

Background and Aim:Newcastle disease is one of the most common diseases affecting poultry in Bangladesh. The disease can cause up to 100% mortality but is preventable if birds are timely and properly vaccinated with a vaccine of standard virus titer. Different live vaccines are commercially available in the country - most, if not all, are produced using lentogenic strains of the virus with variable virulence. One of the disadvantages of these vaccines is that they are not stable at high environmental temperature, and therefore, a proper cold chain must be maintained during transportation and storage. Information on how long these vaccine viruses can withstand environmental temperature, which is near the vicinity of 37°C in the summer season in Bangladesh, is scanty. The aim of this research was to measure the effect of temperature on virus titer of live ND virus vaccines and to develop a real-time reverse transcription polymerase chain reaction (rRT-PCR) standard curve to indirectly determine hemagglutination (HA) titer of virus by this highly sensitive method.Materials and Methods:In this study, thermostability of five commercial live vaccines containing LaSota, F, Clone 30, and B1 type LaSota strains was observed for up to 35 days keeping them at 37°C. From the most thermostability yielding sample, two rRT-PCR standard curves were developed: (1) By plotting the cycle threshold (CT) values as obtained from 10-fold serial dilutions up to 10−3 against their corresponding log (to the base 10) dilutions and (2) by plotting the CT values obtained from serial HA dilutions up to 2−4 against their corresponding HA titer dilutions. The PCR efficiencies based on which the graphs were fitted were also evaluated.Results:The vaccine from the LaSota strain withstood 37°C for 35 days with a gradual declination of HA titer over time, and this vaccine also had the highest initial HA titer, which was 211. The vaccine made from F strain was inactivated quickly, and it had the lowest HA titer at the beginning of the study. The first standard curve developed can be used to assess the level of virus titer in a diluted sample compared with the titer in the original undiluted vaccine preparation by plotting the CT value obtained from the dilution by rRT-PCR. The second standard curve can be used to calculate the HA titer of a vaccine dilution by plotting the CT value as obtained from the dilution by rRT-PCR.Conclusion:The regression equations for the first and second graphs were y=−3.535x+14.365 and y=−1.081x+13.703, respectively, suggesting that, for every 3.53 cycles, the PCR product would have increased 10 times and 2 times for every 1.08 cycles, respectively, indicating nearly (but not exactly) 100% PCR efficiency.

Development of a coagglutination kit as a rapid test for diagnosing Newcastle disease in poultry

“…Next, denaturation was performed at 94°C for 40 s, followed by annealing at 55°C for 30 s, and elongation at 72°C for 60 s (35 cycles). Finally, postelongation was performed at 72°C for 4 min (1 cycle) [ 11 ].…”

Newcastle disease virus LaSota strain induces apoptosis and activates the TNFα/NF‐κB pathway in canine mammary carcinoma cells

“…The nude mice were necropsied and internal organs were collected to detect presence of NDV with PCR, NDV primer sequence: F: GAGCTAATGAACATTCTTTC; R: AATAGGCGGACCACATCTG 35 . Tumour was harvested and placed in 10% formalin solution, then haematoxylin–eosin (H&E) staining was performed for histological analysis and immunohistochemistry (IHC) was performed to evaluated the expression of NDV‐HN (1:200; bs‐4529R, Bioss, Boston, USA) and caspase‐3 (1:200; 19677‐1‐AP, PTG, Chicago, USA).…”

“…The nude mice were necropsied and internal organs were collected to detect presence of NDV with PCR, NDV primer sequence: F: GAGCTAATGAACATTCTTTC; R: AATAGGCGGACCACATCTG. 35 Tumour was harvested and placed in 10% formalin solution, then haematoxylin-eosin (H&E) staining was performed for histological anal- described, 36 for quantification, the integrated optical density (IOD) of the IHC were analysed using Image-Pro Plus 6.0 software (Media Cybernetics, Maryland, USA).…”

Production of Newcastle Disease Polyclonal Antibody as the Alternative of Immunohistochemistry Primary Antibody against Newcastle Disease in Poultry

“…The primer was obtained from the Disease Investigation Center (DIC) Lampung, Indonesia. The procedure of RT-PCR was conducted following the procedure of the previous study without any modification (Dhar et al, 2018).…”