Varicella-zoster virus (VZV) transcription during latency in human ganglia: detection of transcripts mapping to genes 21, 29, 62, and 63 in a cDNA library enriched for VZV RNA

Abstract

Information on the extent of virus DNA transcription and translation in infected tissue is crucial to an understanding of herpesvirus latency. To detect low-abundance latent varicella-zoster virus (VZV) transcripts, poly(A) ؉ RNA extracted from latently infected human trigeminal ganglia was enriched for VZV transcripts by hybridization to biotinylated VZV DNA. After hybridization, the RNA-DNA hybrid was isolated by binding to avidin-coated beads and extensively washed, and the RNA was released by heat denaturation. A lambda-based cDNA library was then constructed from the enriched RNA. PCR and DNA sequencing of DNA extracted from the cDNA library revealed the presence of VZV genes 21, 29, 62, and 63, but not VZV genes 4, 10, 40, 51, and 61, in the enriched cDNA library. These findings confirm the detection of VZV gene 29 and 62 transcripts on Northern (RNA) blots prepared from latently infected human ganglia (J.

Detection of varicella‐zoster virus DNA in 414 human trigeminal ganglia from cadavers by the polymerase chain reaction: A comparison of the detection rate of varicella‐zoster virus and herpes simplex virus type 1

“…DNA was extracted using a QIAamp 1 DNA Mini Kit (Qiagen, Hilden, Germany). VZV DNA and HSV-1 DNA were detected by PCR with the primers shown in Table I [Cohrs et al, 1996;Kennedy et al, 1998;Markoulatos et al, 2001]. PCR amplification was performed in 50 ml reaction mixtures containing 50 pmol of each primer, 0.2 mM dNTP, 1Â PCR buffer (Applied Biosystems, Foster City, CA), and 1.25 U of AmpliTaq Gold 1 DNA polymerase (Applied Biosystems).…”

“…Virol. DOI 10.1002/jmv ACCCTTAGTCAGACTCTGTTACTTACCC 6769 a VZV and HSV-1 DNA primers for VZV ORF 29 and the HSV-1 RL2 region were described previously [Cohrs et al, 1996;Kennedy et al, 1998;Markoulatos et al, 2001]. b Deduced from the following GeneBank accession number for VZV: XO4370.…”

Phenotypic analysis of human CD4+ T cells specific for immediate early 63 protein of varicella‐zoster virus

“…IE63 is a virion tegument protein 6 that is expressed very early in the viral life cycle, initially in the nucleus of infected cells 4. During latency several VZV genes have been shown to be transcribed 7, 8, including IE63 protein, which has been detected in latently infected rat ganglia 4 and human ganglia 9. During latency the IE63 protein is detected exclusively in the cytoplasm of neuronal cells 10.…”

Human Herpesvirus Latency

“…Since the homologous region encoding HSV-1 LAT is absent in the VZV genome, it would not be surprising if the transcriptional pattern of VZV during latency differs from that of HSV-1. At least 5 VZV genes are transcribed in latently infected human ganglia (11,44). Reverse Northern analysis revealed a transcript mapping to the SalI fragment C of the VZV genome during latency (10).…”