VPS72/YL1-Mediated H2A.Z Deposition Is Required for Nuclear Reassembly after Mitosis

Abstract

The eukaryotic nucleus remodels extensively during mitosis. Upon mitotic entry, the nuclear envelope breaks down and chromosomes condense into rod-shaped bodies, which are captured by the spindle apparatus and segregated during anaphase. Through telophase, chromosomes decondense and the nuclear envelope reassembles, leading to a functional interphase nucleus. While the molecular processes occurring in early mitosis are intensively investigated, our knowledge about molecular mechanisms of nuclear reassembly is rather limited. Using cell free and cellular assays, we identify the histone variant H2A.Z and its chaperone VPS72/YL1 as important factors for reassembly of a functional nucleus after mitosis. Live-cell imaging shows that siRNA-mediated downregulation of VPS72 extends the telophase in HeLa cells. In vitro, depletion of VPS72 or H2A.Z results in malformed and nonfunctional nuclei. VPS72 is part of two chromatin-remodeling complexes, SRCAP and EP400. Dissecting the mechanism of nuclear reformation using cell-free assays, we, however, show that VPS72 functions outside of the SRCAP and EP400 remodeling complexes to deposit H2A.Z, which in turn is crucial for formation of a functional nucleus.

The ATPase SRCAP is associated with the mitotic apparatus, uncovering novel molecular aspects of Floating-Harbor syndrome

“…HeLa cells (ATTC company) were cultured in 6-well plates in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS (Corning) and a penicillin/streptomycin solution (Gibco, 15140122). RNAi-mediated depletion of SRCAP was performed by double transfection (24 h + 48 h after seeding) with (i) a specific siRNA mix called SRCAP A (CCAGUUCCCUGACUUAAGATT + GGAUGGAUCUACUAGAGUUTT) targeting SRCAP transcripts at sequences CCAGTTCCCTGACTTAAGA and GGATGGATCTACTAGAGTT (sc-93293, Santa Cruz Biotechnology) and (ii) a single siRNA called SRCAP B (GCGUGAUGUUGAACUGGGAGAUGGA) targeting SRCAP transcript at sequence GCGTGATGTTGAACTGGGAGATGGA, already validated by Moreno-Andres et al [ 60 ]. As negative control, samples were processed in the same way, excluding the addition of siRNA.…”

“…As negative control, samples were processed in the same way, excluding the addition of siRNA. As additional control, we used a scrambled siRNA (CAUCGAGACGCUAGCAGAUCCUGCG), already validated by Moreno-Andres et al [ 60 ]. The Lipofectamine RNAi-MAX reagent (Thermo Scientific) was used for transfections, according to the manufacturer’s protocol; 24 h after the second transfection, cells were harvested for cytological and immunoblotting analysis.…”

Bioinformatics Analysis of Prognostic Significance of VPS72 and Correlations with Immune Infiltrates in Hepatocellular Carcinoma

“…The high mortality rate of liver cancer indicates that most patients are diagnosed at a late stage, and strategies for early detection are needed to reduce the burden of liver cancer [14]. VPS72 is an important factor in functional nuclear recombination after mitosis and prolongs telophase of HeLa cells [15]. Human VPS72, known as YL1, YL-1, or SWC2, was initially identi ed as a nuclear, DNA-binding protein that suppressed anchorage-independent growth suppressor activity in Kirsten sarcoma virus-transformed NIH3T3 cells [16,17].…”

LiveCellMiner: A New Tool to Analyze Mitotic Progression

“…To test the capabilities of LiveCellMiner on the output of common light microscopy systems, we have reexamined the mitotic progression of cells after RNAi-mediated downregulation with negative and positive controls from previously published [33][34][35] November 12, 2021 7/28 and unpublished data sets (LSM710 confocal, see Note S1). Our routine positive control is the RNAi-mediated downregulation of three subunits of the heterotrimeric PP2A complex: PPP2CA (catalytic subunit alpha), PPP2R1A (scaffold subunit alpha) and PPP2R2A (a regulatory subunit B55 alpha).…”

“…In the following sections, we present the individual modules of LiveCellMiner and show how they are used for data import, feature extraction, cell trajectory synchronization, data selection and visualization. The presented proof of principle applications are based on existing data sets from previous publications [37][38][39] where image data were acquired using 2D+t widefield and confocal microscopy in different platforms (see Note S1 for details on the experimental setup).…”