wecB Gene of Salmonella Gallinarum Plays a Critical Role in Systemic Infection of Fowl Typhoid

Abstract

Salmonella enterica serovar Gallinarum (S. Gallinarum) is a host-specific pathogen causing fowl typhoid, a severe systemic infection in poultry, which leads to substantial economic losses due to high morbidity and mortality in many developing countries. However, less is known about the pathogenic characteristics and mechanism of S. Gallinarum-induced systemic infection in chickens. In this study, we deleted the S. Gallinarum UDP-N-acetylglucosamine-1-phosphate transferase gene, which contributes to the biosynthesis of enterobacterial common antigen (ECA), and studied the pathogenicity of this wecB::Cm strain in a chicken model of systemic infection. The wecB::Cm mutant strain showed comparable growth but lower resistance to bile acid and nalidixic acid than the wild-type strain in vitro. In the oral infection model of chickens, the virulence of the wecB::Cm strain was significantly attenuated in vivo. Chickens infected with wild-type strain showed typical clinical signs and pathological changes of fowl typhoid and died between 6 and 9 days post-infection, and the bacteria rapidly disseminated to systemic organs and increased in the livers and spleens. In contrast, the wecB::Cm mutant strain did not cause chicken death, there were no significant clinical changes, and the bacterial numbers in the liver and spleen of the chickens were significantly lower than those of the chickens infected with the wild-type strain. In addition, the expression of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and CXCLi1 in the livers of wecB::Cm-infected chickens was significantly lower than that of the chickens infected with the wild-type strain. Furthermore, the attenuated wecB::Cm strain could persistently colonize the liver and spleen at low levels for up to 25 days post-infection and could induce a protective immune response in the chickens. These results indicate that the wecB gene is an important virulence factor of S. Gallinarum in the chicken model of systemic infection, and the avirulent wecB::Cm mutant could possibly be used as a live-attenuated vaccine strain for controlling fowl typhoid.

Salmonella pathogenicity island-14 is a critical virulence factor responsible for systemic infection in chickens caused by Salmonella gallinarum

“…(B) Spleen, the arrows show degeneration and necrosis in the white pulp. (19). In this study, in contrast, chickens infected with the mSPI-14 mutant showed no significant clinical symptoms, had a 100% survival rate, and showed no differences in gross findings and/or pathological changes compared to the uninfected group.…”

“…To date, studies on the effects of Salmonella enterica SPI-14 on systemic infection of chickens in vivo are very limited. In our recent studies, the chickens infected with S. gallinarum WT died after showing clinical symptoms such as depression and ruffled feathers, and gross examination of the liver showed white punctate lesions and hepatomegaly ( 5 , 19 ). Furthermore, in histopathological analysis, remarkable and widespread inflammatory reactions were observed in organs, such as focal necrosis, heterophils, lymphocyte clusters in the liver, and coagulative necrosis in the spleen ( 19 ).…”

“…Gram stain was performed on fresh single colony smears of each strain, and the shape of the cells was observed under a microscope. To investigate whether growth ability changes between WT and mSPI-14 in different culture conditions, we observed bacterial growth in LB broth containing bile acids (final concentration was 0.01 or 0.02 mM, Sigma-Aldrich), hydrogen peroxide (final concentration of 0.5 or 1.0 mM, Wako, Osaka, Japan), or nalidixic acid (final concentration of 1.25 or 2.5 μg/mL, Wako) in 96-well flat-bottom plates (Greiner BioOne, Kremsmünster, Austria), respectively ( 19 ). The plates were incubated at 37°C without shaking, and the bacterial growth at the indicated time points was determined by monitoring the optical density (OD 600 nm ) using a 96-well plate reader (Bio-Rad, model 680 microplate reader, Hercules, CA, United States).…”

“…RNA was extracted from the livers of chickens infected with WT or mSPI-14 strain and PBS control on days 3 and 5 after infection, and the expression levels of inflammatory cytokines and chemokines were measured by real-time PCR according to our previously reported methods ( 17 , 19 ). GAPDH was used as an endogenous control, and IL-1β, IL-6, TNF-α, IL-12, IFN-γ, and CXCLi1 were used as target genes.…”

“…2.2 Construction of SPI-14 mutant strain (mSPI-14) of Salmonella gallinarum SPI-14 contains the genes of SG0834-0839, among which 0835 and 0836-0838 are genes with distinct functions (Figure 1A). Therefore, the SG0835 and SG0836 genes contained in SPI-14 were deleted from the parental WT strain according to the previously reported methods (18,19). In brief, the PCR primers, SG0835-0836F-1 (TATTGAATTATCAGATGCTCCATTCAAATGAGAGA CGA GAGTAGGCTGGAGCTGCTTCTT) and SG0835-0836R-1 (GTTATGTTCAGCAATAACTAAA GAAGCCATATTTTCCTCC CATATGAATATCCTCCTTAG), were used to amplify the chloramphenicol resistance cassette, and the SG0835-0836 region was replaced by homologous recombination.…”