Y chromosome analysis of native Turkish cattle breeds by microsatellite markers

Abstract

The aim of this study was to determine phylogenetic relationships of 6 native cattle breeds of Turkey using 7 Y chromosomespecific microsatellite DNA markers. DNA samples were isolated from Anatolian Black, Anatolian Grey, South Anatolian Red, Native Southern Anatolian Yellow, East Anatolian Red, and Zavot cattle using a standard phenol/chloroform method. PCR products were separated by capillary electrophoresis and marker genotypes were determined. A total of 41 different alleles were observed. The mean allele number was 5.86 and mean F IS value was 0.427 for all populations. The INRA189 locus was monomorphic for all populations except for South Anatolian Red. UMN0307 and INRA124 loci were monomorphic in the East Anatolian Red and Anatolian Black populations, respectively. The Anatolian Black population was assigned to its own population at a maximum level (78.26%). In this study, a taurine-specific allele was identified in the INRA124 locus. Zebu-and taurine-specific alleles were observed in BM861, INRA189, and UMN0103 loci. Allele 134 in INRA124 seems to be a specific allele of taurine or zebu. The alleles of the UMN0307 and UMN0504 loci need to be investigated for zebu-or taurine-specific alleles. The resulting neighbor-joining tree and structure analysis suggested that the breeds analyzed are consistent with their modern geographical locations.

Y chromosome genetic diversity and breed relationships in nativePolish cattle assessed by microsatellite markers

“…This points to the overall low diversity of the Y-chromosome markers, which may be due to either a low mutation rate or selection affecting the allelic diversity. It has been also shown that particular microsatellite alleles were either indicus-specific allele (INRA189 (88 bp) (Edwards et al, 2000), INRA124 (130 bp) (Edwards et al, 2000;Hanotte et al, 2000), and BM861 (156 bp) (Edwards et al, 2000;Özşensoy et al, 2014)) or were found only in a few individuals from indigenous breeds of different geographical origin (INRA189 (90 bp), INRA189 (82 bp) (Kantanen et al, 2009); INRA124 (134 bp) (Özşensoy et al, 2014)). Regarding studies of Y-chromosome microsatellites, up until now the highest diversity was observed in the INRA189 marker in a wide range of cattle breeds (Ginja et al, 2009;Kantanen et al, 2009;Cortes et al, 2011;Edwards et al, 2011).…”

Genetic Diversity of Eight Domestic Goat Populations Raised in Turkey

“…It was reported that microsatellites had been most frequently used in genetic characterization studies conducted in Asian and African countries [12]. In Turkey, genetic diversity studies with microsatellites had been conducted in goat [13], cattle [14, 15], and horse [16] populations.…”

Maternal Phylogenetics of Some Anatolian Cattle Breeds

“…In terms of nucleotide and haplotype diversity, they showed higher values than other known world cattle breeds [2,4,5,6,7,8,10] when they were compared with all groups. Similarly, the Y chromosome specific markers in Turkish cattle breeds also showed high genetic diversity [26]. Genetic characterization which studied autosomal microsatellites and mtDNA reported that Turkish native cattle breeds had rich genetic diversity [10,27].…”

“…MtDNA D-loop region at position 15738 to 963 was amplified by forward primer (prot-RNA: CTGCAGTCTCACCATCAACC) [1] and revers primer (12SrNA-2: AGGATATAAAGCACCGCCAAG) [26]. Each multiplex for PCR was performed in 60μl reaction volume including 1x Mg ++ free PCR buffer (Fermentas), 0.125 mM dNTPs (Fermentas), 1.5 mM MgCl ++ , 0.375 U of Tag polymerase (Fermentas), 2 -17 pMol each primer and ~100 ng of genomic DNA.…”