A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

Three isolates of Tomato torrado virus (ToTV) were found in Poland. The isolates were characterized on the basis of their symptomatology on plant species, serological reactions, electron microscopy, and nucleotide and amino acid sequence analyses of coat protein subunit genes. In comparative tests, the Polish ToTV isolates were shown to be closely related to each other and also to the isolate from Spain.

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5′ CAATGTGCCAAAGATGAGCG 3′), TR1R (5′ ACTCCCGTGTCTATGTTTTC 3′), TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same. References: (1) R. C. Larsen et al. Phytopathology 74:795, 1984. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Main conclusionColeoptera, the largest and the most diverse Insecta order, is characterized by multiple adaptations to plant feeding. Insect-associated microorganisms can be important mediators and modulators of interactions between insects and plants.Interactions between plants and insects are highly complex and involve multiple factors. There are various defense mechanisms initiated by plants upon attack by herbivorous insects, including the development of morphological structures and the synthesis of toxic secondary metabolites and volatiles. In turn, herbivores have adapted to feeding on plants and further sophisticated adaptations to overcome plant responses may continue to evolve. Herbivorous insects may detoxify toxic phytocompounds, sequester poisonous plant factors, and alter their own overall gene expression pattern. Moreover, insects are associated with microbes, which not only considerably affect insects, but can also modify plant defense responses to the benefit of their host. Plants are also frequently associated with endophytes, which may act as bioinsecticides. Therefore, it is very important to consider the factors influencing the interaction between plants and insects. Herbivorous insects cause considerable damage to global crop production. Coleoptera is the largest and the most diverse order in the class Insecta. In this review, various aspects of the interactions among insects, microbes, and plants are described with a focus on coleopteran species, their bacterial symbionts, and their plant hosts to demonstrate that many factors contribute to the success of coleopteran herbivory.

Thrips palmi (from the order Thysanoptera) is a serious insect pest of various crops, including vegetables, fruits and ornamental plants, causing significant economic losses. Its presence constitutes a double threat; not only does T. palmi feed on the plants, it is also a vector for several plant viruses. T. palmi originated in Asia, but has spread to North and Central America, Africa, Oceania and the Caribbean in recent decades. This species has been sporadically noted in Europe and is under quarantine regulation in the European Union. For non-specialists its larval stages are indistinguishable morphologically from another widespread and serious insect pest Frankliniella occidentalis (a non-quarantine species in the European Union) as well as other frequently occurring thrips. In this study, we have developed a loop-mediated isothermal amplification protocol to amplify rDNA regions of T. palmi. The results were consistent whether isolated DNA or crushed insects were used as template, indicating that the DNA isolation step could be omitted. The described method is species-specific and sensitive and provides a rapid diagnostic tool to detect T. palmi in the field.