No abstract

The presence of the 34-kDa hyaluronan binding protein 1 (HABP1) on sperm surface and its role in fertilization is already established (Ranganathan et al., 1994: Mol Reprod Dev 38:69-76). In the present communication, we examined the expression of HABP1 in adult rat testis during spermatogenesis. Interestingly, using anti-rHABP1 antibody, we detected a protein of 55 kDa which was present only in testis, but not in other somatic tissues like spleen and liver. However, even in testis, only one transcript of HABP1 mRNA of 1.63 kb was observed. In addition, we confirm that this testis-specific 55 kDa protein was immunologically identical with proprotein form of HABP1 using antibody raised against a decapeptide present in the proprotein region of HABP1. Comparative immunohistochemistry of testis, spleen, and liver tissues using both the antibodies supported the observation that the proprotein form of HABP1 is present only in testis. Higher mRNA expression of HABP1 in testis as compared to that of liver and spleen could be speculated from the RT-PCR product. Finally, detailed study of the immunohistochemical staining of the seminiferous tubules revealed the expression of the HABP1 proprotein in specific stages of germ cells, like pachytene spermatocytes and round spermatids, but not in elongated ones, suggesting a possible role of HABP1 proprotein in spermatogenic differentiation.

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.

The proprotein form of hyaluronan binding protein 1 (HABP1) has been reported to be present in the pachytene spermatocytes and the round spermatids of the adult testis. To explore the role of HABP1 proprotein in spermatogenesis, its expression in the testes of adult rats was compared with that in the testes of developing rats and that in the testes of adult rats that received estriadiol to halt spermatogenesis. Immunoblotting revealed that the mature form of HABP1 was consistently present in the testis, but its precursor form was not found in the testis of animals aged 7, 14, 21, and 28 days. However, immunohistochemical analysis revealed the presence of the proprotein form in the pachytene spermatocytes and the round spermatids of testes from rats aged 21 and the 28 days, the appearance of which correlated well with the appearance of these cells during spermatogenesis. Reversetranscriptase polymerase chain reaction revealed transcriptional upregulation of HABP1 in the testes of adult rats, compared with the testes of developing rats. Finally, loss of HABP1 proprotein expression from the pachytene spermatocytes and round spermatids was observed in the testes from rats in which spermatogenesis was arrested. Collectively, these findings demonstrate the appearance of HABP1 proprotein in the pachytene spermatocytes and the round spermatids during the initial stages of postnatal testis development and suggest that this expression may be crucial for spermatogenesis.

No abstract