Free radicals can cause damage to human skin, so antioxidants are needed to counteract the negative effects of these free radicals, for example preparations in the form of face masks. For tomatoes (Solanum lycopersicum L.) contains nutritious substances, namely lycopene which can be useful as an antioxidant in the skin. This study aims to determine the effect of variations in kaolin and bentonite bases on physical characteristics and antioxidant activity of tomato lycopene extract clay mask, and to determine the best formula. Tomato lycopene extract (Solanum lycopersicum L.) was modified into a microemulsion preparation to keep antioxidant activity stable. Kaolin and bentonite which were used as bases had various concentrations in each formula, namely F1 15% and 2%, F2 20% and 1.5%, F3 25% and 1%, F4 30% and 0.5%, respectively. The results showed that the four clay mask preparations were homogeneous and did not change in color, shape and aroma. The pH test on the four formulas is F1 4.33 ± 0.35, F2 5.58 ± 0.24, F3 6.48 ± 0.22, F4 7.34 ± 0.08. The viscosity test on the four formulas, namely F1 20213.3 ± 140.4, F2 24133.3 ± 83.26, F3 29080 ± 105.83, F4 33293.3 ± 378.06. The spreadability test was F1 6.59 ± 0.24, F2 5.59 ± 0.16, F3 4.85 ± 0.11, F4 7.84 ± 0.05. The test time for the preparation to dry was F1 19.02 ± 0.36, F2 15.33 ± 0.54, F3 11.27 ± 0.42, F4 8.24 ± 0.50. Easy-to-clean tests i.e. F1 and F2 are very easy to clean, F3 and F4 are easy to clean. The best formula for clay masks is the F3 preparation where the concentration of kaolin is 25% and bentonite is 1%.

Graphical abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Benalu batu (B. medicinalis) is a plant endemic to Central Sulawesi that has been reported to possess anticancer, antioxidant, and antiviral activities. The mechanism of action of these activities is still unclear. This study aimed to evaluate the immunostimulatory effect of ethanol extract of B. medicinalis on an in vivo model by measuring the macrophage phagocytotic activity and cytokine production of tumor necrosis factor-alpha (TNF-α) and interferon-gamma (IFN-γ) on male mice and rats, respectively. The extract was obtained by the maceration method for 3 × 24 h using 70% ethanol. The doses of the extract were 60, 120, and 240 mg/kg body weight (bw). The percentage of macrophage phagocytosis and the TNF-α, and IFN-γ levels were measured on the eighth day, one hour after intraperitoneal injection of Staphylococcus aureus ATCC 25923. The result showed that ethanol extract of B. medicinalis activated macrophage phagocytosis in a dose-dependent manner, with a significant increase in cytokine expression of TNF-α and IFN-γ. The optimal dose was 240 mg/kg bw, with a higher percentage of phagocytic activity and higher levels of TNF-α and IFN-γ than Stimuno® as a positive control and other dosage treatments. This study suggests that B. medicinalis ethanol extract has the effect of an immunomodulator and provides a scientific basis for traditional usage of this herb plant.

Hepatitis B virus (HBV) infects human and causes chronic liver infection, leading to liver cirrhosis and hepatocellular carcinoma. HBV X (Hbx) protein is known to interact with tumor suppressor protein p53 and block its translocation into the nucleus. This study outlines the overproduction of Hbx protein from HBV subgenotype B3 in Escherichia coli BL21(DE3), including its purification and refolding. The gene encoding Hbx was first codon-optimized and inserted into pET16b. The recombinant plasmid was then transformed into E. coli BL21(DE3) as an expression host. Optimization of Hbx expression was performed with variation of IPTG concentration and overproduction temperature. The results showed that Hbx protein was optimally induced by 0.075 mM IPTG and overproduction of Hbx at 17, 25, and 37°C exhibited no difference in protein level and location. The optimal refolding of Hbx was obtained using 0.1 M arginine prior to elution from Nickel column using 100 mM imidazole and 0.25 M arginine. Hbx migrates differently in SDS-PAGE reducing and non-reducing, while the melting curve pattern in TSA analysis changed after the refolding step. Essentially, this purified Hbx protein could potentially be used for interaction study with p53 and the inhibitor candidate of the protein.