T-cell acute lymphoblastic leukemia (T-ALL) is caused by the cooperation of multiple oncogenic lesions1,2. We used exome sequencing on 67 T-ALLs to gain insight into the mutational spectrum in these leukemias. We detected protein-altering mutations in 508 genes, with an average of 8.2 mutations in pediatric and 21.0 mutations in adult T-ALL. Using stringent filtering, we predict seven new oncogenic driver genes in T-ALL. We identify CNOT3 as a tumor suppressor mutated in 7 of 89 (7.9%) adult T-ALLs, and its knockdown causes tumors in a sensitized Drosophila melanogaster model3. In addition, we identify mutations affecting the ribosomal proteins RPL5 and RPL10 in 12 of 122 (9.8%) pediatric T-ALLs, with recurrent alterations of Arg98 in RPL10. Yeast and lymphoid cells expressing the RPL10 Arg98Ser mutant showed a ribosome biogenesis defect. Our data provide insights into the mutational landscape of pediatric versus adult T-ALL and identify the ribosome as a potential oncogenic factor.

Tumor suppressor genes on the X chromosome may skew the gender distribution of specific types of cancer1,2. T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy with an increased incidence in males3. In this study, we report the identification of inactivating mutations and deletions in the X-linked plant homeodomain finger 6 (PHF6) gene in 16% of pediatric and 38% of adult primary T-ALL samples. Notably, PHF6 mutations are almost exclusively found in T-ALL samples from male subjects. Mutational loss of PHF6 is significantly associated with leukemias driven by aberrant expression of the homeobox transcription factor oncogenes TLX1 and TLX3. Overall, these results identify PHF6 as a new X-linked tumor suppressor in T-ALL and point to a strong genetic interaction between PHF6 loss and aberrant expression of TLX transcription factors in the pathogenesis of this disease.

We identified a duplication of the MYB oncogene in 8.4% of individuals with T cell acute lymphoblastic leukemia (T-ALL) and in five T-ALL cell lines. The duplication is associated with a threefold increase in MYB expression, and knockdown of MYB expression initiates T cell differentiation. Our results identify duplication of MYB as an oncogenic event and suggest that MYB could be a therapeutic target in human T-ALL.

IntroductionT-cell acute lymphoblastic leukemia (T-ALL) is an aggressive malignancy characterized by the accumulation of undifferentiated thymocytes that have acquired multiple genomic aberrations affecting critical transcriptional and signaling pathways. 1,2 T-ALL is also frequently characterized by the expression of constitutively activated tyrosine kinases, such as ABL1, LCK, JAK1, and JAK3. [3][4][5][6][7] Recently identified mutations in the IL-7 receptor ␣ (IL-7R) and deletions of the tyrosine phosphatase PTPN2 were also reported to affect tyrosine kinase signaling. [8][9][10] The genetic and functional data presented in this work now identify the tyrosine phosphatase CD45 as a new tumor suppressor gene in T-ALL. CD45 is a transmembrane protein that is abundantly present on the surface of all nucleated hematopoietic cells. CD45 is encoded by the PTPRC gene and is known to regulate phosphorylation of SRC and JAK family kinases. 11-13 Methods Cell cultureHEK293T and human T-ALL cell lines were cultured in RPMI 1640 medium supplemented with FBS. MOHITO cells were cultured and transduced as described previously. 14 For dose-response curves, T-ALL cell lines were seeded out in triplicate in 24-well plates at a density of 5 ϫ 10 5 cells/mL and incubated for 48 hours with the JAK family kinase inhibitor INCB018424 (Chemietek). Viable cell numbers were determined using CellTiter 96 AQ ueous One Solution (Promega) and a Victor X4 plate reader (PerkinElmer Life and Analytical Sciences). Patient samples and sequence analysisPatient genomic DNA was collected at various institutions at time of diagnosis and remission. All samples were obtained according to the guidelines of the local ethics committees at KU Leuven, and informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. All coding exons of PTPRC as well as exon 6 of IL-7R were amplified and PCR products were directly sequenced. ConstructsThe open reading frames of wild-type and mutant CD45R0 were cloned into pMSCV-Puro (Clontech). Retroviral vectors expressing nonsilencing or CD45 targeting shRNAs were obtained by cloning short hairpin RNA sequences into a pMSCV-GFP construct containing a mir30 flanking cassette. shRNA sequences: CTCGCTTGGGCGAGAGTAA (shControl) and AGCAGATGATATTCCAAAGAAA (shCD45). Western blottingThe following antibodies were used: anti-CD45 (clone 69; BD Biosciences); anti-phospho-JAK1 (Tyr1022/1023), anti-STAT5 (clone L-20; Santa Cruz Biotechnology); anti-JAK1 (clone73; Millipore); anti-phospho-STAT5 (Tyr694), anti-phospho-STAT3 (Tyr705), anti-STAT3 (79D7; Cell Signaling); anti-beta actin (Sigma-Aldrich). For personal use only. on March 24, 2019. by guest www.bloodjournal.org From Immunocomplex phosphatase activity assayDiFMUP immunocomplex phosphatase activity assay 15 was performed as described earlier. 16 Conversion of DiFMUP into DiFMU was monitored using a Victor X4 plate reader. Initial conversion rates were calculated from the slope of the linear curve of fluorescence versus time for each substrate c...

Chromosomal translocations with breakpoints in T-cell receptor (TCR) genes are recurrent in T-cell malignancies. These translocations involve the TCRad gene (14q11), the TCRb gene (7q34) and to a lesser extent the TCRc gene at chromosomal band 7p14 and juxtapose T-cell oncogenes next to TCR regulatory sequences leading to deregulated expression of those oncogenes. Here, we describe a new recurrent chromosomal inversion of chromosome 7, inv(7)(p15q34), in a subset of patients with T-cell acute lymphoblastic leukemia characterized by CD2 negative and CD4 positive, CD8 negative blasts. This rearrangement juxtaposes the distal part of the HOXA gene cluster on 7p15 to the TCRb locus on 7q34. Real time quantitative PCR analysis for all HOXA genes revealed high levels of HOXA10 and HOXA11 expression in all inv (7) positive cases. This is the first report of a recurrent chromosome rearrangement targeting the HOXA gene cluster in T-cell malignancies resulting in deregulated HOXA gene expression (particularly HOXA10 and HOXA11) and is in keeping with a previous report suggesting HOXA deregulation in MLL-rearranged T-and B cell lymphoblastic leukemia as the key factor in leukaemic transformation. Finally, our observation also supports the previous suggested role of HOXA10 and HOXA11 in normal thymocyte development.