The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCAClTICATCITCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron microscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 105 cells after killing of

Protein A from Staphylococcus aureus, in soluble form or coupled to Sepharose beads, acts as a polyclonal B cell activator (PBA) for human lymphocytes in blood and spleen. PBA activity was demonstrated in spleen cells by the ability of protein A to induce the formation of intracellular immunoglobulin synthesis and to activate polyclonal antibody secretion demonstrated against fluorescein isothiocyanate-coupled sheep erythrocytes in a modified hemolysis in gel assay. More plaqueforming cells (PFC) were seen in unseparated cells than in purified B cells. In blood lymphocytes, only few PFC were activated by soluble protein A. Protein A increased DNA synthesis in blood and spleen cells. At a concentration of 100 microgram/ml the peak response was on day 4 or 5, but at 1 microgram/ml the peak response occurred later. On day 4 of culture, high mitogenic activity was seen in unseparated lymphocytes or mixtures of separated B and T cells, whereas in enriched B and T cell suspensions activity was low. On day 7, however, DNA synthesis in both the enriched B and T cells was higher than in mixtures of B and T cells. Protein A stimulated DNA synthesis in thymus cells with a peak response on day 6. It is concluded that protein A alone or as an IgG complex can activate both B and T cells, though the mechanism of activation is not known and may be different for B and T cells.

Antibacterial factors were purified from human adenoid glands by tissue extraction and consecutive steps of reversedphase chromatography and assayed for bactericidal activity against the airway pathogen Moraxella catarrhalis and also Escherichia coli and Bacillus megaterium. One of the most active components isolated from adenoids was identified by N-terminal sequence analysis and mass spectrometry as high mobility group box chromosomal protein 1 (HMGB1). This novel finding was further substantiated by Western blot analysis, demonstrating a protein of expected size reactive with HMGB1 antiserum. Local synthesis was confirmed by reversetranscriptase PCR and in situ hybridization. Adenoid-derived HMGB1 and recombinant HMGB1 revealed comparable antibacterial activity at high rate. More than 95% of bacteria were eradicated within 5 min by HMGB1 in the cultures. Secretion from the adenoid gland surface was also demonstrated to contain antibacterial activity, mainly mediated by ␣-defensins, but not by HMGB1. We conclude that HMGB1, produced and stored intracellularly in the adenoid gland, contributes to the local antibacterial barrier defense system in the upper respiratory tract. Innate immunity refers to the part of the eukaryotic antimicrobial defense machinery that acts and kills invaders within seconds or minutes. The main effector molecules in this system are gene-derived antimicrobial peptides (peptide antibiotics), and this applies both to plants and animals, including invertebrates and vertebrates (1, 2). More than 500 antimicrobial peptides have been described to date, of which only 30 have been identified in humans (3). Of these, some are small peptides such as defensins and some are well-characterized larger proteins such as lysozyme, phospholipase A 2 , and bactericidal permeability increasing protein, contained in neutrophil granules. Another group consists of cleaved fragments of larger proteins such as lactoferrin and cathepsin G.It was recently reported that nasal secretion contains antimicrobial activity (4) and that the oral mucosa and salivary glands produce ␤-defensins (5). The adenoid or pharyngeal tonsil is a part of the mucosa-associated lymphatic tissue responsible for regional immune functions in the upper respiratory tract. The adenoid has been investigated for production

No abstract