No abstract

No abstract

Onions (Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production (Wolfe and Stubbs, 2017). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves (Fig. 1A,B), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique (Jenkins, 1964). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females (Fig. 2A-C) identified the species as Paratrichodorus minor (Colbran) Siddiqi; (Decraemer, 1995). Nematode body shape was "cigar-shaped" with dorsally curved "onchiostyle" stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females (n = 20) included: body length 671.1 (570.1-785.3) µm; body width 32.5 (27.8-37.0) µm; onchiostyle 32.5 (31.1-34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2-128.5) µm; a 21.5 (15.3-28.1) µm; b 5.2 (4.9-6.3) µm; V 52.9% (48.1-55.4%) µm; and vagina length 8.7 (7.8-10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females (n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5¢ CTACCACATCCAAGGAAGGC 3¢)/932R (5¢ TATCTGATCGCTGTCGAACC 3¢), D2A (5¢ ACAAG TACCGTGAGGGAAAGTTG 3¢)/D3B (5¢ TCGGAAGGAACCAGCTAC TA 3¢), and BL18 (5¢ CCCGTCGCTACTACCGATT 3¢)/5818 (5¢ ACGARCCGAGTGATCCAC 3¢), respectively (

Onion bulb rot can be caused by multiple plant pathogens including bacterial pathogens. During our routine survey of commercial onion farms in 2014, 2020, and 2021, seven putative Rouxiella spp. strains were isolated from symptomatic onion samples in Georgia, United States. Upon fulfilling Koch’s postulates on onion, a genome analysis was conducted. Whole-genome indices (ANI and dDDH) showed that the strains belonged to Rouxiella badensis. Although the seven R. badensis strains were not pathogenic on onion foliage, the strains were able to cause bulb rot and could also produce necrotic lesions in a red onion scale assay. R. badensis populations increased significantly and to a level comparable to P. ananatis PNA 97-1R in a red onion scale infection assay. The core-genome analysis grouped all onion R. badensis strains from Georgia together, and distinct from R. badensis strains isolated from other sources and locations. Based on the genome analysis of strains (from the current study and available genomes in the repository), type I, III (Ssa-Esc and Inv-Mxi-Spa types), and V secretion systems are present in R. badensis genomes, while type II, IV, and VI secretion systems are absent. However, various secondary metabolite gene clusters were identified from R. badensis genomes, and a thiol/redox-associated enzyme gene cluster similar to the Pantoea alt cluster mediating thiosulfinate tolerance was also present in onion strains of R. badensis. This is the first report of R. badensis as a plant pathogen.