Coronavirus, an important zoonotic disease, raises concerns of future pandemics. The bat is considered a source of noticeable viruses resulting in human and livestock infections, especially the coronavirus. Therefore, surveillance and genetic analysis of coronaviruses in bats are essential in order to prevent the risk of future diseases. In this study, the genome of HCQD-2020, a novel alphacoronavirus detected in a bat (Eptesicus serotinus), was assembled and described using next-generation sequencing and bioinformatics analysis. The comparison of the whole-genome sequence and the conserved amino acid sequence of replicated proteins revealed that the new strain was distantly related with other known species in the Alphacoronavirus genus. Phylogenetic construction indicated that this strain formed a separated branch with other species, suggesting a new species of Alphacoronavirus. Additionally, in silico prediction also revealed the risk of cross-species infection of this strain, especially in the order Artiodactyla. In summary, this study provided the genetic characteristics of a possible new species belonging to Alphacoronavirus.

The complete mitogenome of the Korean hare (Lepus coreanus) was determined by the long and accurate polymerase chain reaction and primer-walking methods. The mitogenome of the Korean hare is 17,472 bp in length and contains sequences that encode 13 protein genes, 22 tRNAs, 2 rRNAs and a noncoding control region. The mitogenome is arranged in an identical order to that found in most other vertebrates. All mitochondrial genes are encoded on the heavy strand, except for eight tRNA genes and the ND6 gene. The control region contains putative termination associated elements, conserved sequence blocks and short and long tandem repeats motifs.

Bats have been identified as a natural reservoir of several potentially zoonotic viruses, including Lyssavirus, Ebola virus, Marburg virus, Hendra virus, Nipah virus, as well as severe acute respiratory syndrome and Middle East respiratory syndrome coronavirus (CoV). Here, we performed a molecular epidemiological investigation of South Korean bat viruses. Genetic comparative analysis was performed on the spike glycoprotein gene of the detected MERS-related CoVs. Among 1640 samples (348 oral swabs, 1199 faecal samples, 83 urine samples and 10 bat carcass) collected across 24 South Korean provinces during 2017-2019, CoV was detected in 82 samples (75 faeces and seven oral swab samples) from 11 provinces. Surveillance over the 3 years during which samples were collected revealed significantly higher CoV detection rates between spring and autumn, and a high detection rate in Vespertillionidae and Rhinolophidae bats. Our phylogenetic analysis shows that Korean bat CoVs are genetically diverse regardless of their spatiotemporal distribution and their host species, and that the discovered bat CoVs belong to various subgenera within the Alpha-and Betacoronavirus genera. Twenty detected MERS-related CoVs belonging to the genus Betacoronavirus were similar to the Ia io bat CoV NL140422 and NL13845 strains. A comprehensive genetic analysis of two Korean bat MERS-related CoV spike receptor binding domain (RBDs)(176 and 267 strains) showed that the 18 critical residues that are involved in interactions with the human DPP4 receptor are most similar to the NL13845 strain, which is known to not bind with hDPP4. A deeper analysis of the interfacing residues in the Korean bat MERS-related CoVs RBD-hDPP4 complexes showed that the Korean bat CoVs has fewer polar contacts than the NL13845 strain. Although further study will be needed, these results suggest that Korean bat MERS-related CoVs are unlikely to bind with hDPP4. Nevertheless, these findings highlight the need for continuous monitoring to identifying the origin of new infectious diseases, specifically mutant CoV.

No abstract

Here, we report the complete mitogenome of Myotis frater with the GenBank accession number MH177276 as a first step to elucidate genetic characteristics of this species. Its mitogenome was 17,089 bp long and consisted of 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes, and a control region. The gene order and composition of M. frater was similar to that of most other vertebrates. The base composition of the 13 PCG in descending order was A (33.8%), C (22.7%), T (30.4%), and G (13.1%), with an AT content of 64.2%. Four overlapping regions in ATP8/ATP6, ATP6/COX3, ND4L/ ND4, and ND5/ND6, among the 13 PCGs were found. The 935 bp long control region is located between tRNA-Pro and tRNA-Phe with 4 ATTACATAATACATTATATGTATAATCGTACATTAAATTAACTCCCACA TGAATATTAAGCATGTCCATACTAATATTAAT-repeat at 5 0 region and 45 ACGCAT-repeat at 3 0 terminus. Phylogenetic analysis suggested that M. frater is most closely related to M. bechsteinii (KX757757), it was supported by 100% bootstrap under both ML and NJ tree. ARTICLE HISTORY