Tomato chlorosis virus (ToCV) is an emerging crinivirus in Brazil that causes an economically important disease in tomato (Solanum lycopersicum) and other solanaceous species. ToCV is transmitted predominantly by the whitefly Bemisia tabaci Middle East‐Asia Minor 1 (MEAM1, formerly biotype B), in a semipersistent manner. As all cultivated tomato varieties and hybrids are susceptible to this crinivirus, the main alternatives for the control of the disease are the use of healthy seedlings for transplanting and the chemical control of the insect vector. The objective of this work was to evaluate the responses of tomato genotypes to infection with this crinivirus and their tolerance to the disease in order to support the development of other alternatives for disease control. Resistance to infection was evaluated by ToCV inoculation with viruliferous B. tabaciMEAM1 followed by virus detection by RT‐PCR and RT‐qPCR. To measure tolerance to the disease, plant development and fruit yield of ToCV‐infected and healthy plants were compared. Among 56 genotypes, only the lineage IAC‐CN‐RT (S. lycopersicum ‘Angela Gigante’ × S. peruvianum ‘LA 444‐1’) was highly resistant to infection with ToCV. Tolerance to the disease over two trials with different genotypes showed variable results. The effect of ToCV on plant development varied from 2.9% to 71.9% reduction, while yield loss varied from 0.2% to 51.8%. The highly ToCV‐resistant lineage IAC‐CN‐RT, which is also resistant to a Spanish isolate of ToCV, might be useful for tomato breeding programmes.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription–polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

RESUMOPalavras-chave adicionais: Diplodia, resistência genética, Stenocarpella macrospora, Zea mays A mancha-de-macrospora, causada pelo fungo Stenocarpella macrospora, tem se mostrado frequente e importante na cultura do milho no Brasil. A resistência genética é uma das principais estratégias de controle de doenças foliares do milho. No Brasil, são escassas as informações sobre resistência de híbridos à S. macrospora. O objetivo deste trabalho foi avaliar a reação de 25 híbridos de milho à mancha-de-macrospora. O experimento foi conduzido em 2011, em casa de vegetação com condições controladas de temperatura e umidade relativa do ar. O delineamento experimental foi inteiramente casualizado, com cinco repetições, sendo as unidades experimentais constituídas por um vaso com cinco plantas. A inoculação foi feita no estádio fenológico V2 (duas folhas totalmente expandidas), depositando no cartucho de cada planta 2,0 mL da suspensão de 1,8x10 4 conídios mL Macrospora leaf spot, caused by the fungus Stenocarpella macrospora, has shown to be frequent and important among corn fields in Brazil. Genetic resistance is one of the main strategies to control corn leaf diseases. In Brazil, there is scarce information on the resistance of hybrids to Stenocarpella macrospora. The aim of this study was to evaluate the reaction of 25 corn hybrids to macrospora leaf spot. The experiment was conducted in 2011, in a greenhouse under controlled temperature and relative humidity conditions. Experimental design was completely randomized, with five replicates, each experimental unit consisting of a pot with five plants. Inoculation was done in the V2 growth stage (two fully expanded leaves), and the whorl of each plant received 2.0 mL suspension of 1. Additional keywords: Diplodia, genetic resistance, Stenocarpella macrospora, Zea mays ABSTRACT fungal isolates were obtained from infected crop residues at the municipalities Lages and Quilombo, Santa Catarina State, and Campinas do Sul and Vacaria, Rio Grande do Sul State. Disease severity was assessed at 21 days after inoculation in the V4 stage (four fully expanded leaves). No tested hybrid was totally resistant to the fungus S. macrospora. There was a significant difference in the disease severity between hybrids and fungal isolates. Hybrids inoculated with Quilombo isolate showed four reaction groups, while the isolates Vacaria, Lages and Campinas do Sul showed two groups. Some hybrids had varied behaviors against the isolates, suggesting different aggressiveness levels. There were hybrids that showed similar reaction to the isolates, suggesting greater stability for macrospora leaf spot.O milho (Zea mays L.) é uma das principais culturas exploradas no Brasil. A importância desse cultivo é caracterizada pela sua utilização na alimentação humana e animal. A área semeada e a produção vêm aumentando nas últimas décadas, porém a produtividade brasileira é considerada baixa se comparada ao potencial produtivo da cultura (9, 12).As doenças foliares afetam a produtividade do milho (2, 13). A...

Tomato severe rugose virus (ToSRV) and tomato chlorosis virus (ToCV) are among the major viruses that affect tomato (Solanum lycopersicum) development and yield in Brazil. ToSRV and ToCV are transmitted in a persistent circulative and semi-persistent manner, respectively, by the whitefly Bemisia tabaci Middle East-Asia Minor 1 (MEAM1), considered the main vector of these viruses. In this study, the kinetics of systemic invasion and the latent and incubation periods of ToSRV and ToCV were evaluated in singly- and doubly-infected tomato plants. Both viruses moved systemically into tomato plants as early as one day after inoculation. The mean ToCV latent periods in single and co-infections with ToSRV were 13 and 11 days, respectively, while incubation periods in single and co-infections were, on average, 30 and 31 days, respectively. For ToSRV, the mean latent period was 7 days in single infections and 6 days in co-infections with ToCV. Incubation periods were, on average, 18 and 17 days in single and co-infections, respectively. As latent periods for both viruses were shorter than their respective incubation periods, field-infected tomato plants may act as sources of inocula soon after infection and before onset of symptoms.

Current control of tomato golden mosaic disease, caused in Brazil predominantly by tomato severe rugose virus (ToSRV), is dependent on both, planting resistant/tolerant hybrids and intensive insecticide sprays (two to three per week) for controlling Bemisia tabaci, the vector of ToSRV. Resistant hybrids only confer moderate resistance to infection by ToSRV and some tolerance to the disease. Insecticide sprays, although widely used, have failed in most tomato production areas in Brazil, as they are unable to reduce primary spread, i.e., infection caused by the influx of viruliferous whiteflies coming from external sources of inoculum. Severe epidemics are recurrently observed in some tomato fields in several Brazilian regions, which prompted us to postulate the existence in the agroecosystem, in some places and time, of amplifier hosts that provide the necessary force of infection for epidemics to occur, even in the absence of secondary spread in the target crop. Amplifier hosts are ideally asymptomatic, occur in high density near the target crop, and support growth of both virus and vector. Soybean and common bean are potential amplifier hosts for begomovirus in tomato crops. Our results support the hypothesis that soybean plants may play an important role as an amplifier host of ToSRV for tomato crops in the field, although this does not seem to be a frequent phenomenon. Successful amplification will depend on several factors, including the soybean cultivar, the soybean stage of development at the moment of infection, the ToSRV isolate, and the perfect synchrony between the beginning of a soybean field and the end of a ToSRV-infected crop, and, later, between the senescence of the ToSRVinfected soybean plants and the new tomato crop. The concept of amplifier hosts has been widely used in ecology of zoonoses but, to our knowledge, has never been used in botanical epidemiology.