No abstract

Immature mosquito species composition and abundance were studied in irrigated and rain-fed rice fields of North Sulawesi, Indonesia. Irrigated rice fields were characterized by the prevalence of aquatic macrophytes and cyprinodont larvivorous fish, Aplocheilus panchax (Hamilton), but abundance per dip of most aquatic insect predators was lower than that in rain-fed rice fields. Anopheles peditaeniatus (Leicester), Culex vishnui Theobald, and Culex tritaeniorhynchus Giles, were dominant in both irrigated and rain-fed fields, but the abundance of the Culex species was lower in irrigated fields. The effect of irrigation system introduction on regional mosquito abundance cannot be evaluated by the enlarged surface water area alone. Changes in habitat quality, expressed as the abundance per dip (index of density per unit water area), also need to be considered.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5′CCCGGATCCTCTAATTCATCCCT3′; IndC: 5′GACGGATCCCACATGTTTGCCA3′) was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

This study was carried out in the laboratory and in the field at City of Bitung, Districts of Minahasa.  The cause of disease was studied in the laboratory and the percentage of insidence of disease was carried out in the field. Results showed that the cause of antracnose disease in North Sulawesi was Colletotrichum gloeosporioides (Penz.) Penz & Sacc. in Penz (Cg). Computation of the antracnose disease insidence showed that variety white hot chili has the highest disease insidence which is 16.50% followed by green hot chili 10.13%, and the lowest is curled chili which is 9.03%.  The different in this rate is affected by pathogen, host plant and the environment. Field observation showed that this disease has already spread at all chili plantation at the City of Bitung and District of Minahasa. Keywords: Chili, antracnose, Colletotrichum gloeosporioides

The arenga species group, hitherto consisting of three species, Colocasiomyia arenga, C. pararenga and C. sagittata, is separated from the genus Colocasiomyia, and established as the new genus Arengomyia Yafuso and Toda, gen. nov. Of the three species, C. pararenga Okada, 1990 is synonymized with C. arenga (Okada, 1987). A new species, Arengomyia xanthopleura Yafuso and Toda, sp. nov., is also described. Supplementary descriptions and revisions of some morphological characters are also provided for the known species.