Error-free mitosis depends on accurate chromosome attachment to spindle microtubules, which is monitored by the spindle assembly checkpoint (SAC) signaling. As an upstream factor of SAC, the precise and dynamic kinetochore localization of Mps1 kinase is critical for initiating and silencing SAC signaling. However, the underlying molecular mechanism remains elusive. Here, we demonstrated that the multisite interactions between Mps1 and Ndc80 complex (Ndc80C) govern Mps1 kinetochore targeting. Importantly, we identified direct interaction between Mps1 tetratricopeptide repeat domain and Ndc80C. We further identified that Mps1 C-terminal fragment, which contains the protein kinase domain and C-tail, enhances Mps1 kinetochore localization. Mechanistically, Mps1 C-terminal fragment mediates its dimerization. Perturbation of C-tail attenuates the kinetochore targeting and activity of Mps1, leading to aberrant mitosis due to compromised SAC function. Taken together, our study highlights the importance of Mps1 dimerization and multisite interactions with Ndc80C in enabling responsive SAC signaling.

Cyclophilins are a subgroup of highly conserved protein family immunophilins which are peptidyl-prolyl isomerases that interconvert between the cis and trans positions. They can act as chaperones in maintaining conformational quality control of proteomes. They are structurally conserved throughout evolution and have been found in mammals, plants, insects, fungi, and bacteria. They share a common fold architecture consisting of 8 antiparallel beta sheets and two alpha helices that pack against the sheets. They exist in the cellular compartment of most tissues and encode special functions. Intracellular Cyclophilins are secreted from cells in response to inflammatory stimuli and can mediate intercellular communication. Pro-inflammatory signals may be stimulated by extracellular Cyclophilin. Overexpression of Cyclophilins can contribute to pathological conditions. Cyclophilins are involved in the pathogenesis of viral infection, neurodegenerative diseases, ageing and cancer. Exhibiting several molecular functions, Cyclophilins can bind to cyclosporine and calcium-dependent ser/thr Calcineurin and has been used to describe the immunosuppressive action of cyclosporine. Cyclophilin can stabilize the cis-trans conformation transition state and speed up isomerization steps in protein folding. This process is important in the assembly of multiple domain proteins. Their existence as foldases and molecular chaperones enable them to be able to assist in the covalent folding or unfolding and the assembly or disassembly of other macromolecular structures.

The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.