The present study was undertaken to further examine a model for the mechanism of action of thio-phosphate in cells using the cultured human cell line HEK 293 and the bacterium E. coli. Previous work has shown that thio-phosphate is incorporated into the nucleic acids of all types of cells and that this modification leads to the stabilization and accumulation of mRNA in vivo. Evidently, competition for translation occurs between cellular mRNAs, due to the limited number of ribosomes in the cell, which impacts the proteins synthesized. In both E. coli and HEK 293 cells, a global shift in the distribution of proteins on 2D gels was observed when cells were grown in the presence of thio-phosphate. In both cases, a significant fraction of the proteins were impacted, namely 17 % in E. coli and 28 % in HEK 293 cells. In general, those proteins originally expressed at lower levels were enhanced while those at higher levels were reduced. In addition, a correlation was observed between the % initial mass and the fold change observed, supporting the idea of a global shift. Furthermore, the potential identity of some proteins spots was obtained by comparisons with computed MW and pI values for known genes. The candidates were cross-referenced with known mRNA half-lives when available. The analysis supports the idea that a preferential accumulation of proteins derived from mRNAs with half-lives less than the cellular mRNA average occurred, at the expense of those proteins derived from mRNAs with half-lives greater than the cellular average. In summary, thio-phosphate is shown to be a useful tool for predictably shifting the distribution of proteins in a variety of cell types. The fold enhancement is typically 5- to 10-fold. Interestingly, there were some proteins elevated more than 20-fold, identifying potential regulatory responses. Some of these were further characterized using LC-MS/MS.

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

The use of murine dihydrofolate reductase (dhfr) gene amplification mutants enabled us to identify important structural and functional features of the dhfr promoter region. We found another transcription unit, at least 14 kilobases in size, which initiates within 130 base pairs of the major dhfr transcript and is transcribed divergently. The 5' ends of both transcripts were analyzed and found to have multiple initiation sites. The major dhfr transcript and the divergent transcript appear to share the same promoter region; the longer transcripts of the dhfr gene overlap with the divergent transcripts and use a different promoter region. The divergent transcript appears to code for a protein; an homologous sequence to its first exon is found in the corresponding location near the human dhfr gene.

Previous work has shown that thiophosphate, a phosphate analogue, leads to a global shift in the distribution of cellular proteins in a variety of organisms. Thiophosphate, when added to culture media, gets incorporated into the nucleic acids of cells resulting in nuclease-resistant phosphorothioate linkages. Using Escherichia coli, as a model organism, it was found that the global changes in protein expression induced with thiophosphate could be accounted for by significant changes in the absolute transcription levels of more than 1500 genes detected via RNA seq analysis. In fact, 58% of transcripts detected in RNA seq studies using total RNA were increased an average of 44 × fold while the remaining 42% were decreased an average of 20 × fold in thiophosphate-treated cells. Furthermore, microarray results showed no correlation between the transcriptional changes observed and the known stability of the corresponding mRNAs measured. Overall, the total amount of non-ribosomal RNA accumulated in TP-treated cells was increased relative to rRNA ~ 4 × fold (1.5-6 ×). The results further indicated that metabolic changes may play a role in inducing the transcriptional profiles observed with thiophosphate. Indeed, pathway analysis of transcripts showed an increase in routes for phosphoribosyl pyrophosphate (PRPP) synthesis and related derivatives, presumably due to a reduction in RNA turnover. These results raise the possibility that the energy savings with reduced RNA turnover could lead to an increased energy charge in the cell that induces transcriptional changes leading to an increase in biosynthetic processes.

No abstract