Achieving high sensitivity in solid-state gas sensors can allow the precise detection of chemical agents. In particular, detection of volatile organic compounds (VOCs) at the parts per billion (ppb) level is critical for the early diagnosis of diseases. To obtain high sensitivity, two requirements need to be simultaneously satisfied: (i) low electrical noise and (ii) strong signal, which existing sensor materials cannot meet. Here, we demonstrate that 2D metal carbide MXenes, which possess high metallic conductivity for low noise and a fully functionalized surface for a strong signal, greatly outperform the sensitivity of conventional semiconductor channel materials. TiCT MXene gas sensors exhibited a very low limit of detection of 50-100 ppb for VOC gases at room temperature. Also, the extremely low noise led to a signal-to-noise ratio 2 orders of magnitude higher than that of other 2D materials, surpassing the best sensors known. Our results provide insight in utilizing highly functionalized metallic sensing channels for developing highly sensitive sensors.

In the formation of chiral crystals, the tendency for twist in the orientation of neighboring molecules is incompatible with ordering into a lattice: Twist is expelled from planar layers at the expense of local strain. We report the ordered state of a neat material in which a local chiral structure is expressed as twisted layers, a state made possible by spatial limitation of layering to a periodic array of nanoscale filaments. Although made of achiral molecules, the layers in these filaments are twisted and rigorously homochiral--a broken symmetry. The precise structural definition achieved in filament self-assembly enables collective organization into arrays in which an additional broken symmetry--the appearance of macroscopic coherence of the filament twist--produces a liquid crystal phase of helically precessing layers.

Equilibrium unilamellar vesicles are stabilized by one of two distinct mechanisms depending on the value of the bending constant. Helfrich undulations ensure that the interbilayer potential is always repulsive when the bending constant, K, is of order k BT. When K Ͼ Ͼ k BT, unilamellar vesicles are stabilized by the spontaneous curvature that picks out a particular vesicle radius; other radii are disfavored energetically. We present measurements of the bilayer elastic constant and the spontaneous curvature, R o, for three different systems of equilibrium vesicles by an analysis of the vesicle size distribution determined by cryo-transmission electron microscopy and smallangle neutron scattering. For cetyltrimethylammonium bromide (CTAB)͞sodium octyl sulfonate catanionic vesicles, K ‫؍‬ .7 k BT, suggesting that the unilamellar vesicles are stabilized by Helfrich-undulation repulsions. However, for CTAB and sodium perfluorooctanoate (FC7) vesicles, K ‫؍‬ 6 kBT, suggesting stabilization by the energetic costs of deviations from the spontaneous curvature. Adding electrolyte to the sodium perfluorooctanoate͞CTAB vesicles leads to vesicles with two bilayers; the attractive interactions between the bilayers can overcome the cost of small deviations from the spontaneous curvature to form two-layer vesicles, but larger deviations to form three and more layer vesicles are prohibited. Vesicles with a discrete numbers of bilayers at equilibrium are possible only for bilayers with a large bending modulus coupled with a spontaneous curvature.

994). 13. A PCR processes were performed on a Perkn-Elmer GeneAmp PCR system 9600 macnne. For POA processng, 4 pmol of each DNA fragment and 2 unts of A m p T a q DNA polymerase, Stoffel fragment (Perkn-Elmer) In PCR buffer 110 m M trs-HCI, 50 mM KCI, 2.2 m M MgCl,. 0.8 m M deoxynucleotlde trlpnosphate (dNTP). pH 8.3, at 25"CI to a total volume of 40 i*. were processed for 40 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). For general PCR. 0.2 i*.l of template sou t o n . 20 pmol of prmers. and 2 unts of Taq DNA polymerase (Gbco-BRL) In PCR buffer [50 m M KCI, 10 m M trls-HCI, 2 mM MgCl,, 10 m M (NH4),S04, 0 8 m M dNTP. pH 8.8, at 2S0C] to a volume of 40 pl were processed for 25 cycles (94°C for 30 s, 65°C for 30 s. and 72°C for 30 s). 14 T i e restrcton enzyme dgest operaton was conducted follow~ng the protocol of New England Boabs.15 T i e mutageness process followed standard protocols (20). (I) \.We added a tall to the ends of answer DNA that IS iomologous (complementary) to parts of M I 3 pnage DNA. PCR v11ti s p e c a y desgned prmers was a p p e d for t n s purpose. One prmer conslsted of 12-bp DNA homologous to M I 3 piage DNA (posltlons 6269 to 6280) and 15 bp of PC (GCT-GGAGCTCCACGTAGAATTCTGCGA); tne other prmer conssted of 12-bp DNA complementary to Mlapnage DNA (postons 6375 to 6386) and 15 bp of P, (GAATTGGGTACCCTGGATCCCGCCC). The frst prmer was phosphoryated at the 5 ' end ~11th T4 polynucleot~de knase (New England Boabs). ( I ) Tne dsDNA of the PCR souton In step (I) was dgested by X exonucease (Gbco-BRL) follow~ng the s u p per's nstructons. The DNA strand that contans a 5 ' piosphate was ihus dgested. ( I ) Mutagenetc M13 pnage DNA (contanng answer DNA) was syntneszed usng the ssDNA from step ( I ) as prmer and wd-type M I 3 pnage DNA as template 16. Transfecton, piage purfcaton, and DNA extracton were conducted follow~ng standard protocols (20).T i e DNA sequencng was done by tne Rockefeller Unvers~ty Proten/DNA Tecinoogy Center 17. The DNA In t i e data pool was purlfled by etianol precptaton, T i e ssDNA was dgested In S1 nucease buffer (50 m M N&c. 280 m M NaCI. and 4.5 m M ZnSO,) v11ti 2 unts of S1 nucease at room temperature for 2 mln 18. K. A. Eckert and T. A. Kunke. PCR veth hods Appl.