The discovery of electrically conducting organic crystals and polymers has widened the range of potential optoelectronic materials, provided these exhibit sufficiently high charge carrier mobilities and are easy to make and process. Organic single crystals have high charge carrier mobilities but are usually impractical, whereas polymers have good processability but low mobilities. Liquid crystals exhibit mobilities approaching those of single crystals and are suitable for applications, but demanding fabrication and processing methods limit their use. Here we show that the self-assembly of fluorinated tapered dendrons can drive the formation of supramolecular liquid crystals with promising optoelectronic properties from a wide range of organic materials. We find that attaching conducting organic donor or acceptor groups to the apex of the dendrons leads to supramolecular nanometre-scale columns that contain in their cores pi-stacks of donors, acceptors or donor-acceptor complexes exhibiting high charge carrier mobilities. When we use functionalized dendrons and amorphous polymers carrying compatible side groups, these co-assemble so that the polymer is incorporated in the centre of the columns through donor-acceptor interactions and exhibits enhanced charge carrier mobilities. We anticipate that this simple and versatile strategy for producing conductive pi-stacks of aromatic groups, surrounded by helical dendrons, will lead to a new class of supramolecular materials suitable for electronic and optoelectronic applications.

Natural pore-forming proteins act as viral helical coats and transmembrane channels, exhibit antibacterial activity and are used in synthetic systems, such as for reversible encapsulation or stochastic sensing. These diverse functions are intimately linked to protein structure. The close link between protein structure and protein function makes the design of synthetic mimics a formidable challenge, given that structure formation needs to be carefully controlled on all hierarchy levels, in solution and in the bulk. In fact, with few exceptions, synthetic pore structures capable of assembling into periodically ordered assemblies that are stable in solution and in the solid state have not yet been realized. In the case of dendrimers, covalent and non-covalent coating and assembly of a range of different structures has only yielded closed columns. Here we describe a library of amphiphilic dendritic dipeptides that self-assemble in solution and in bulk through a complex recognition process into helical pores. We find that the molecular recognition and self-assembly process is sufficiently robust to tolerate a range of modifications to the amphiphile structure, while preliminary proton transport measurements establish that the pores are functional. We expect that this class of self-assembling dendrimers will allow the design of a variety of biologically inspired systems with functional properties arising from their porous structure.

994). 13. A PCR processes were performed on a Perkn-Elmer GeneAmp PCR system 9600 macnne. For POA processng, 4 pmol of each DNA fragment and 2 unts of A m p T a q DNA polymerase, Stoffel fragment (Perkn-Elmer) In PCR buffer 110 m M trs-HCI, 50 mM KCI, 2.2 m M MgCl,. 0.8 m M deoxynucleotlde trlpnosphate (dNTP). pH 8.3, at 25"CI to a total volume of 40 i*. were processed for 40 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). For general PCR. 0.2 i*.l of template sou t o n . 20 pmol of prmers. and 2 unts of Taq DNA polymerase (Gbco-BRL) In PCR buffer [50 m M KCI, 10 m M trls-HCI, 2 mM MgCl,, 10 m M (NH4),S04, 0 8 m M dNTP. pH 8.8, at 2S0C] to a volume of 40 pl were processed for 25 cycles (94°C for 30 s, 65°C for 30 s. and 72°C for 30 s). 14 T i e restrcton enzyme dgest operaton was conducted follow~ng the protocol of New England Boabs.15 T i e mutageness process followed standard protocols (20). (I) \.We added a tall to the ends of answer DNA that IS iomologous (complementary) to parts of M I 3 pnage DNA. PCR v11ti s p e c a y desgned prmers was a p p e d for t n s purpose. One prmer conslsted of 12-bp DNA homologous to M I 3 piage DNA (posltlons 6269 to 6280) and 15 bp of PC (GCT-GGAGCTCCACGTAGAATTCTGCGA); tne other prmer conssted of 12-bp DNA complementary to Mlapnage DNA (postons 6375 to 6386) and 15 bp of P, (GAATTGGGTACCCTGGATCCCGCCC). The frst prmer was phosphoryated at the 5 ' end ~11th T4 polynucleot~de knase (New England Boabs). ( I ) Tne dsDNA of the PCR souton In step (I) was dgested by X exonucease (Gbco-BRL) follow~ng the s u p per's nstructons. The DNA strand that contans a 5 ' piosphate was ihus dgested. ( I ) Mutagenetc M13 pnage DNA (contanng answer DNA) was syntneszed usng the ssDNA from step ( I ) as prmer and wd-type M I 3 pnage DNA as template 16. Transfecton, piage purfcaton, and DNA extracton were conducted follow~ng standard protocols (20).T i e DNA sequencng was done by tne Rockefeller Unvers~ty Proten/DNA Tecinoogy Center 17. The DNA In t i e data pool was purlfled by etianol precptaton, T i e ssDNA was dgested In S1 nucease buffer (50 m M N&c. 280 m M NaCI. and 4.5 m M ZnSO,) v11ti 2 unts of S1 nucease at room temperature for 2 mln 18. K. A. Eckert and T. A. Kunke. PCR veth hods Appl.

Alignment of lamellar block copolymer microstructure in an electric field was studied. Two mechanisms of alignment are considered: selective electric-field-induced disordering and alignment through movement of defects. The latter mechanism is supported by the findings that, in an aligned sample, defect structures exhibited a highly anisotropic arrangement and were spatially clumped. An analysis of fieldinduced forces on disclination lines and defect walls is presented. Also, defect interactions are considered. Through the interplay between these forces, the alignment process, the kinetics of alignment, and clumping of defects can be rationalized.