We recently developed a genome-length hepatitis C virus (HCV) RNA replication system (OR6) with luciferase as a reporter. The OR6 assay system has enabled prompt and precise quantification of HCV RNA replication. Pegylated interferon (IFN) and ribavirin combination therapy is the world standard for chronic hepatitis C, but its effectiveness is limited to about 55% of patients. Newer therapeutic approaches are needed. In the present study, we used the OR6 assay system to evaluate the anti-HCV activity of 3-hydroxy-3-methylglutaryl coenzyme A ( P ersistent hepatitis C virus (HCV) infection causes liver fibrosis and hepatocellular carcinoma. Approximately 170 million people worldwide are infected with HCV. The combination of pegylated interferon (IFN) with ribavirin is the current standard therapy for chronic hepatitis C (CHC) and yields a sustained virological response (SVR) rate of about 55%. 1 This means that about 45% of patients with CH C are still threatened by the progression of the disease to cirrhosis and hepatocellular carcinoma. Until 1999, when Lohmann et al. developed the subgenomic replicon of HCV, it was difficult to screen anti-HCV reagents. 2 Many improvements followed that breakthrough, such as a genome-length HCV RNA replication system 3,4 and a subgenomic replicon with a reporter assay system 5 ; more recently, Wakita et al. used a genotype 2a strain, JFH1, to produce the infectious virus in cell culture. [6][7][8] Genotype 1 is the major genotype of HCV found in Japan, the United States, and many other countries. Unfortunately, the SVR rate after combination therapy of pegylated IFN with ribavirin is less than 50% for this genotype. To find a more effective therapy especially for CHC patients with genotype 1, we recently developed a genome-length HCV RNA (strain O of genotype 1b) replication reporter system (OR6), which has been an effective screening tool. 9,10 Statins, which are 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, are in wide use for the treatment of hypercholesterolemia. Recently, it

DDX3, a DEAD-box RNA helicase, binds to the hepatitis C virus (HCV) core protein. However, the role(s) of DDX3 in HCV replication is still not understood. Here we demonstrate that the accumulation of both genome-length HCV RNA (HCV-O, genotype 1b) and its replicon RNA were significantly suppressed in HuH-7-derived cells expressing short hairpin RNA targeted to DDX3 by lentivirus vector transduction. As well, RNA replication of JFH1 (genotype 2a) and release of the core into the culture supernatants were suppressed in DDX3 knockdown cells after inoculation of the cell culture-generated HCVcc. Thus, DDX3 is required for HCV RNA replication.DEAD-box RNA helicases are involved in various RNA metabolic processes, including transcription, translation, RNA splicing, RNA transport, and RNA degradation (9,20). DDX1 and DDX3, DEAD-box RNA helicases, have been implicated in the replication of human immunodeficiency virus type 1 (HIV-1). Both DDX1 and DDX3 interact with HIV-1 Rev and enhance Rev-dependent HIV-1 RNA nuclear export (10,24).On the other hand, DDX3 binds to the hepatitis C virus (HCV) core protein (17,19,25), and DDX3 expression is deregulated in HCV-associated hepatocellular carcinoma (HCC) (7,8). However, the biological function of DDX3 in HCV replication is still not understood. To address this issue, we first used lentivirus vector-mediated RNA interference to stably knock down DDX3 in three HuH-7-derived cell lines: O cells, harboring a replicative genome-length HCV RNA (HCV-O, genotype 1b) (13); sO cells, harboring its subgenomic replicon of HCV RNA (14); or RSc cured cells, which cell culture-generated HCV (HCVcc) (JFH1, genotype 2a) (23) could infect and effectively replicate in (M. Ikeda et al., unpublished data). Oligonucleotides with the following sense and antisense sequences were used for the cloning of short hairpin RNA (shRNA)-encoding sequences against DDX3 in the lentivirus vector: for DDX3i#3, 5Ј-GATCCCCGGAGGA AATTATAACTCCCTTCAAGAGAGGGAGTTATAATTT CCTCCTTTTTGGAAA-3Ј (sense) and 5Ј-AGCTTTTCCAA AAAGGAGGAAATTATAACTCCCTCTCTTGAAGGGA GTTATAATTTCCTCCGGG-3Ј (antisense); for DDX3i#7, 5Ј-GATCCCCGGTCACCCTGCCAAACAAGTTCAAGAG ACTTGTTTGGCAGGGTGACCTTTTTGGAAA-3Ј (sense) and 5Ј-AGCTTTTCCAAAAAGGTCACCCTGCCAAACAA GTCTCTTGAACTTGTTTGGCAGGGTGACCGGG-3Ј (antisense). These oligonucleotides were annealed and subcloned into the BglII-HindIII site, downstream from an RNA polymerase III promoter of pSUPER (6). To construct pLVDDX3i#3 and pLV-DDX3i#7, the BamHI-SalI fragments of the corresponding pSUPER plasmids were subcloned into the BamHI-SalI site of pRDI292 (5), an HIV-1-derived self-inactivating lentivirus vector containing a puromycin resistance marker allowing for the selection of transduced cells. The vesicular stomatitis virus G protein (VSV-G)-pseudotyped HIV-1-based vector system has been described previously (18). We used the second-generation packaging construct pCMV-⌬R8.91 (26) and the VSV-G-envelope plasmid pMDG2. The lentivirus vector particles were produced by transient transfection of 293FT cells with FuGe...

No abstract

During viral replication, the innate immune response is induced through the recognition of viral replication intermediates by host factor(s). One of these host factors, cyclic GMP-AMP synthetase (cGAS), was recently reported to be involved in the recognition of viral DNA derived from DNA viruses. However, it is uncertain whether cGAS is involved in the recognition of hepatitis B virus (HBV), which is a hepatotropic DNA virus. In the present study, we demonstrated that HBV genome-derived doublestranded DNA induced the innate immune response through cGAS and its adaptor protein, stimulator of interferon genes (STING), in human hepatoma Li23 cells expressing high levels of cGAS. In addition, we demonstrated that HBV infection induced ISG56 through the cGAS-STING signaling pathway. This signaling pathway also showed an antiviral response towards HBV through the suppression of viral assembly. From these results, we conclude that the cGAS-STING signaling pathway is required for not only the innate immune response against HBV but also the suppression of HBV assembly. The cGAS-STING signaling pathway may thus be a novel target for anti-HBV strategies.

No abstract