Type IV P-type ATPases (P4-ATPases) are putative phospholipid flippases that translocate phospholipids from the exoplasmic (lumenal) to the cytoplasmic leaflet of lipid bilayers and are believed to function in complex with CDC50 proteins. In Saccharomyces cerevisiae, five P4-ATPases are localized to specific cellular compartments and are required for vesicle-mediated protein transport from these compartments, suggesting a role for phospholipid translocation in vesicular transport. The human genome encodes 14 P4-ATPases and three CDC50 proteins. However, the subcellular localization of human P4-ATPases and their interactions with CDC50 proteins are poorly understood. Here, we show that class 5 (ATP10A, ATP10B, and ATP10D) and class 6 (ATP11A, ATP11B, and ATP11C) P4-ATPases require CDC50 proteins, primarily CDC50A, for their exit from the endoplasmic reticulum (ER) and final subcellular localization. In contrast, class 2 P4-ATPases (ATP9A and ATP9B) are able to exit the ER in the absence of exogenous CDC50 expression: ATP9B, but not ATP11B, was able to exit the ER despite depletion of CDC50 proteins by RNAi. Although ATP9A and ATP9B show a high overall sequence similarity, ATP9A localizes to endosomes and the trans-Golgi network (TGN), whereas ATP9B localizes exclusively to the TGN. A chimeric ATP9 protein in which the N-terminal cytoplasmic region of ATP9A was replaced with the corresponding region of ATP9B was localized exclusively to the Golgi. These results indicate that ATP9B is able to exit the ER and localize to the TGN independently of CDC50 proteins and that this protein contains a Golgi localization signal in its N-terminal cytoplasmic region.In eukaryotic cells, the lipid bilayer of the plasma membrane as well as membranes of secretory and endocytic compartments exhibits asymmetric lipid distributions; aminophospholipids, phosphatidylserine (PS), 3 and phosphatidylethanolamine are concentrated in the cytoplasmic leaflet (1, 2). For example, in resting human red blood cells, PS and phosphatidylethanolamine are restricted primarily to the inner leaflet of the plasma membrane, whereas phosphatidylcholine and sphingomyelin are exposed on the cell surface (3, 4). Regulated exposure of PS in the outer leaflet occurs in many biological processes, such as apoptotic cell death, platelet coagulation reactions, and the fusion of muscle (4 -7); similarly, phosphatidylethanolamine is exposed on the surface of the cleavage furrow during cytokinesis (8). In addition, phospholipid asymmetry of the bile canalicular membrane is critical to membrane integrity and normal bile secretion by hepatocytes (9); loss of phospholipid asymmetry due to mutations in the human FIC1/ATP8B1 (a member of the P4-ATPase family) gene causes a liver disease, progressive familial intrahepatic cholestasis (10).P4-ATPases are a subfamily of P-type ATPases and have been implicated in flipping aminophospholipids from the exoplasmic (lumenal) leaflet to the cytoplasmic leaflet (11-15). The yeast P4-ATPases (Drs2p, Neo1p, Dnf1p, Dnf2p, and Dnf3p) a...

Under diabetic conditions, sodium–glucose cotransporter 2 (SGLT2) for glucose uptake in proximal tubules (PTs) increases, whereas NAD+-dependent protein deacetylase silent mating type information regulation 2 homolog 1 (Sirtuin-1; SIRT1) for PT survival decreases. Therefore, we hypothesized that increased glucose influx by SGLT2 reduces SIRT1 expression. To test this hypothesis, db/db mice with diabetes and high-glucose (HG)-cultured porcine PT LLC-PK1 cells in a two-chamber system were treated with the SGLT2 inhibitor canagliflozin. We also examined SIRT1 and SGLT2 expression in human kidney biopsies. In db/db mice, SGLT2 expression increased with concomitant decreases in SIRT1, but was inhibited by canagliflozin. For determination of the polarity of SGLT2 and SIRT1 expression, LLC-PK1 cells were seeded into Transwell chambers (pore size, 0.4 µm; Becton Dickinson, Oxford, UK). HG medium was added to either or to both of the upper and lower chambers, which corresponded to the apical and basolateral sides of the cells, respectively. In this system, the lower chamber with HG showed increased SGLT2 and decreased SIRT1 expression. Canagliflozin reversed HG-induced SIRT1 downregulation. Gene silencing and inhibitors for glucose transporter 2 (GLUT2) blocked HG-induced SGLT2 expression upregulation. Gene silencing for the hepatic nuclear factor-1α (HNF-1α), whose nuclear translocation was enhanced by HG, blocked HG-induced SGLT2 expression upregulation. Similarly, gene silencing for importin-α1, a chaperone protein bound to GLUT2, blocked HG-induced HNF-1α nuclear translocation and SGLT2 expression upregulation. In human kidney, SIRT1 immunostaining was negatively correlated with SGLT2 immunostaining. Thus, under diabetic conditions, SIRT1 expression in PTs was downregulated by an increase in SGLT2 expression, which was stimulated by basolateral HG through activation of the GLUT2/importin-α1/HNF-1α pathway.

No abstract

PAGE 38161:The evidence shown in Fig. 1 that ATP10A is expressed in HeLa cells is not correct. ATP10A expression was measured using RT-PCR with the sense (ccttatccccagtcacagctg) and anti-sense (ccgagtctgcctcttggtacc) primer pair. However, subsequent cloning and sequencing of the RT-PCR product showed that the original primer pair amplified glucosidase, beta, acid (GBA, XM006726211.1) by annealing to the mRNA of GBA (XM006726211.1) at positions 541 and 823 (marked with an asterisk in the revised Fig. 1) rather than ATP10A mRNA. When we examined ATP10A expression using two other primer pairs (pair 1, cacaatgttcgtgggcctcc (sense) and aaggacactgaagccacacg (anti-sense); pair 2, gtctccgaattcaatcctttgac (sense) and ccgagtctgcctcttggtacc (anti-sense)), we detected ATP10A expression in MDA-MB-231 cells but not in HeLa cells (Fig. 1 Addendum). Therefore, we conclude that the band identified as ATP10A in the original Fig. 1 was a product of GBA mRNA amplification, and ATP10A expression was not detected in HeLa cells. This correction does not affect the results or conclusions of this work.

We have recently published that tubular epithelial cells affect the podocyte epigenome though nicotinic acid metabolism in diabetic nephropathy (DN), and we have named this relationship "proximal tubule-podocyte communication". In this review, we describe this novel mechanism in the early stage of DN, focusing on the function of renal tubular Sirt1 and Sirt1-related nicotinic acid metabolism. Mainly, we discuss the following three findings. First, we described the details of proximal tubule-podocyte communication. Second, we explained how Sirt1 regulates albuminuria via epigenetic mechanisms. This means that repeated high glucose stress triggers the initial changes in proximal tubules, which lead to the epigenetically irreversible glomerular damages. However, proximal tubular Sirt1 overexpression can rescue these changes. Our previous data indicated that the decrease in Sirt1 expression in proximal tubules caused the reduction in glomerular Sirt1 and the subsequent increase in glomerular Claudin-1. It seemed plausible that some humoral mediator is released from proximal tubules, migrates to podocytes and glomeruli, and affects Sirt1 expression in podocytes. Third, we mentioned a mediator connecting this communication, nicotinamide mononucleotide (NMN). We suggest the potential of Sirt1 or NMN as not only a therapeutic target but also as a prognostic marker of very early stage DN.