Leucine-rich repeats and immunoglobulin-like domains 3 (Lrig3) was identified by microarray analysis among genes that show differential expression during gastrulation in Xenopus laevis. Lrig3 was expressed in the neural plate and neural crest (NC) at neurula stages, and in NC derivatives and other dorsal structures during tailbud stages. A prominent consequence of the morpholino-induced inhibition of Lrig3 expression was impaired NC formation, as revealed by the suppression of marker genes, including Slug, Sox9 and Foxd3. In the NC induction assay involving Chordin plus Wnt3a-injected animal caps, Lrig3 morpholino inhibited expression of Slug, Sox9 and Foxd3, but not of Pax3 and Zic1. In line with this, Lrig3 knockdown prevented NC marker induction by Pax3 and Zic1, suggesting that Lrig3 acts downstream of these two genes in NC formation. Injection of Lrig3 and Wnt3a led to low-level induction of NC markers and enhanced induction of Fgf3, Fgf4 and Fgf8 in animal caps, suggesting a positive role for Lrig3 in Wnt signaling. Lrig3 could attenuate Fgf signaling in animal caps, did interact with Fgf receptor 1 in cultured cells and, according to context, decreased or increased the induction of NC markers by Fgf. We suggest that Lrig3 functions in NC formation in Xenopus by modulating the Wnt and Fgf signaling pathways.KEY WORDS: Fgf8, MAPK, Neural crest, Slug, Wnt3a, Xenopus laevis, Leucine-rich repeats protein, Animal cap, DNA microarray Development 135, 1283Development 135, -1293Development 135, (2008 DEVELOPMENT Microarray and data analysisThe dissected explants were homogenized in Stat 60 (TEL TEST), RNA was treated with DNase I and purified using RNeasy kit (Qiagen). Biotinylated probe was prepared from 100 ng total RNA using the OVATION RNA amplification system (Nugen Technologies). Probes were hybridized to Xenopus genome arrays (Affymetrix) according to the manufacture's instructions. Hybridized arrays were processed by the GeneChip Fluidics system (Affymetrix), and scanned in the GeneChip Scanner (Affymetrix). Gene expression profiles were analyzed by the GCOS software (Affymetrix). DNA constructsThe ORF of Lrig3 was cloned into pCS2+ (Turner and Weintraub, 1994) or into pCS2flag, pCS2myc and pCS2GFP. The tags were located c-terminal to Lrig3. Deletion mutants of Lrig3 were generated by PCR and subcloned into pCS2myc. Morpholino oligoThe splicing morpholino (Genetools) against Lrig3 (L3MO) recognizes both pseudo-alleles is GGGTTTCTGAAAGATAAAAACAAGC, and the Control-MO is CCTCTTACCTCAGTTACAATTTATA. RESEARCH ARTICLEDevelopment 135 (7) lacZ staining was performed as described (Zhao et al., 2001). Whole-mount in situ hybridization was performed as described (Harland, 1991). The following probes were used: Sox2 (Kishi et al., 2000), Rx2a (Yoshitake et al., 1999), Krox20 (Bradley et al., 1993, Slug (Snail2) (Mayor et al., 1995), Sox9 (Spokony et al., 2002), Ap2a (Luo et al., 2002), Inca (Luo et al., 2007), Myc (Bellmeyer et al., 2003), Twist (Hopwood et al., 1989) and Traf4 (this laboratory) were examined. Al...

The organizer anchors the primary embryonic axis, and balance between dorsal (organizer) and ventral domains is fundamental to body patterning. Ligand of Numb protein-X (LNX) is a RING finger and four PDZ domain containing E3 ubiquitin ligase1,2. LNX serves as a binding platform and may have a role in cell fate determination, but its in vivo functions are unknown1–5. Here we show that Lnx-l (Lnx-like) acts as a critical regulator of dorso-ventral (D-V) axis formation in zebrafish. Depletion of Lnx-l using specific antisense morpholinos (MO), caused strong embryonic dorsalization. We identified Bozozok (Boz; also called Dharma or Nieuwkoid) as a binding partner and substrate of Lnx-l. Boz is a homeodomain-containing transcriptional repressor induced by canonical Wnt signaling that is critical for dorsal organizer formation6–12. Lnx-l induced K48-linked polyubiquitination of Boz, leading to its proteasomal degradation in human 293T cells and in zebrafish embryos. Dorsalization induced by Boz overexpression was suppressed by raising the level of Lnx-l, but Lnx-l failed to counteract dorsalization caused by mutant Boz lacking a critical motif for Lnx-l binding. Further, dorsalization induced by depletion of Lnx-l was alleviated by attenuation of Boz expression. We conclude that Lnx-l modulates Boz activity to prevent the invasion of ventral regions of the embryo by organizer tissue. These studies introduce a ubiquitin ligase, Lnx-l, as a balancing modulator of axial patterning in the zebrafish embryo.

In vertebrate embryos, the dorsal aorta and the posterior cardinal vein form in the trunk to comprise the original circulatory loop. Previous studies implicate Hedgehog (Hh) signaling in the development of the dorsal aorta. However, the mechanism controlling specification of artery versus vein remains unclear. Here, we investigated the cell-autonomous mechanism of Hh signaling in angioblasts (endothelial progenitor cells) during arterial-venous specification utilizing zebrafish mutations in Smoothened (Smo), a G protein-coupled receptor essential for Hh signalling. smo mutants exhibit an absence of the dorsal aorta accompanied by a reciprocal expansion of the posterior cardinal vein. The increased number of venous cells is equivalent to the loss of arterial cells in embryos with loss of Smo function. Activation of Hh signaling expands the arterial cell population at the expense of venous cell fate. Time-lapse imaging reveals two sequential waves of migrating progenitor cells that contribute to the dorsal aorta and the posterior cardinal vein, respectively. Angioblasts deficient in Hh signaling fail to contribute to the arterial wave; instead, they all migrate medially as a single population to form the venous wave. Cell transplantation analyses demonstrate that Smo plays a cell-autonomous role in specifying angioblasts to become arterial cells, and Hh-signaling depleted angioblasts differentiate into venous cells instead. Collectively, these studies suggest that arterial endothelial cells are specified and formed via repressing venous cell fate at the lateral plate mesoderm by Hh signaling during vasculogenesis.