containing 1 x 106 cpm of nick-translated probe per ml (12). After being washed three times at 60'C in 0.5 x SSC to remove excess probe, the filters were exposed to X-ray film (Kodak X-Omat S) at -700C with an intensifying screen. Hybridization-positive phage were isolated, and their inserts were subcloned into the EcoRI site of M13mp8. AVDR1 was obtained in this fashion and subsequently used to screen an Okayama-Berg (13) T47D cDNA library (provided by G. Ringold, Stanford University), yielding clone VDR3, and a specifically primed AgtlO T47D library yielding clone AVDR2. The latter was made by substituting the oligonucleotide 5' ACACACCCCACAGATCCGGGG 3' for oligo(dT) in the first strand reaction (underlined in Fig. 2).DNA Sequence Analysis. Three overlapping clones were used to generate the full-length VDR sequence cDNA inserts to be sequenced. These clones were subcloned into the EcoRI site of M13mp8 for sequencing by the dideoxynucleotide chain-termination method (14). Primers were either the M13 universal primer or sequence-derived oligonucleotides.RNA Blot Hybridization. Total RNA was isolated from each of three cell lines (15), and the mRNA fraction was selected by successive passages over oligo(dT)-cellulose (16). The mRNA samples (10 ,ug) were resolved on a 1% formaldehyde-agarose gel (17) and then transferred electrophoretically to a nylon membrane (Nytran; Schleicher & Schuell). The filter was hybridized to nick-translated hVDR-1(1 x 108 cpm/,ug; 1 x 106 cpm/ml) using the conditions described above.Expression

No abstract

Summary Coactivator-associated arginine methyltransferase 1 (CARM1), a coactivator for various cancer-relevant transcription factors, is overexpressed in breast cancer. To elucidate the functions of CARM1 in tumorigenesis, we knocked out CARM1 from several breast cancer cell lines using Zinc-Finger Nuclease technology, which resulted in drastic phenotypic and biochemical changes. The CARM1 KO cell lines enabled identification of CARM1 substrates, notably the SWI/SNF core subunit BAF155. Methylation of BAF155 at R1064 was found to be an independent prognostic biomarker for cancer recurrence and to regulate breast cancer cell migration and metastasis. Furthermore, CARM1-mediated BAF155 methylation affects gene expression by directing methylated BAF155 to unique chromatin regions (e.g., c-Myc pathway genes). Collectively, our studies uncover a mechanism by which BAF155 acquires tumorigenic functions via arginine methylation.

Serum calcium levels are tightly controlled by an integrated hormone-controlled system that involves active vitamin D [1,25(OH) 2 D], which can elicit calcium mobilization from bone when intestinal calcium absorption is decreased. The skeletal adaptations, however, are still poorly characterized. To gain insight into these issues, we analyzed the consequences of specific vitamin D receptor (Vdr) inactivation in the intestine and in mature osteoblasts on calcium and bone homeostasis. We report here that decreased intestinal calcium absorption in intestine-specific Vdr knockout mice resulted in severely reduced skeletal calcium levels so as to ensure normal levels of calcium in the serum. Furthermore, increased 1,25(OH) 2 D levels not only stimulated bone turnover, leading to osteopenia, but also suppressed bone matrix mineralization. This resulted in extensive hyperosteoidosis, also surrounding the osteocytes, and hypomineralization of the entire bone cortex, which may have contributed to the increase in bone fractures. Mechanistically, osteoblastic VDR signaling suppressed calcium incorporation in bone by directly stimulating the transcription of genes encoding mineralization inhibitors. Ablation of skeletal Vdr signaling precluded this calcium transfer from bone to serum, leading to better preservation of bone mass and mineralization. These findings indicate that in mice, maintaining normocalcemia has priority over skeletal integrity, and that to minimize skeletal calcium storage, 1,25(OH) 2 D not only increases calcium release from bone, but also inhibits calcium incorporation in bone. IntroductionIonized serum calcium levels are critical for the correct functioning of multiple vital cellular processes. Accordingly, the regulation of calcium homeostasis is directed at maintaining serum calcium levels within a narrow physiological range. Briefly, hypocalcemia leads to increased parathyroid hormone (PTH) secretion, which stimulates renal calcium reabsorption and bone resorption. PTH also enhances production of the active form of vitamin D, 1,25(OH) 2 vitamin D [1,25(OH) 2 D], which activates the vitamin D receptor (VDR) in the intestine to increase calcium absorption, and in bone to induce bone resorption (1).Because the diet is the only source of calcium to the body, dietary calcium content is critical for calcium homeostasis. At low dietary calcium intake, active calcium transport controlled by 1,25(OH) 2 D predominates, whereas at high calcium intake, calcium is absorbed via passive diffusion. This model is supported by the observation that intestinal calcium transport is reduced in systemic Vdr-null mice, leading to hypocalcemia, hypophosphatemia, and bone abnormalities that include rickets and hyperosteoidosis. The finding that a high calcium/lactose diet prevents this phenotype con-

RANKL is a tumor necrosis factor (TNF)-like factor secreted by mesenchymal cells, osteoblast derivatives, and T cells that is essential for osteoclastogenesis. In osteoblasts, RANKL expression is regulated by two majorSkeletal remodeling in adults occurs through the coupled actions of bone-forming osteoblasts and bone-resorbing osteoclasts (17). The latter are terminally differentiated, multinucleated cells of the monocyte-macrophage lineage (63). The process of osteoclastogenesis is highly complex and is orchestrated by a number of growth factors, steroidal components, and cytokines, all of which exert their actions in a highly temporal fashion (57). Many of these regulatory factors are produced and secreted by adjacent support cells that include stroma, B and T cells, and cells of the osteoblast lineage. The production of such factors by osteoblasts highlights the extrinsic role that these cells play in the process of bone resorption. Importantly, while many of these secreted components are critical for normal adult bone remodeling, their aberrant secretion can be pathological and lead to either focal or systemic bone disease (45).Although many factors participate in osteoclastogenesis, the molecule that is now considered to be both necessary and sufficient in vivo and in vitro is the receptor activator of NF-B ligand (RankL). RankL is a tumor necrosis factor (TNF)-like factor that is produced by stromal cells and osteoblasts as well as a variety of other cell types (38). This factor not only actively promotes the process of osteoclast differentiation, but also is required for the cell's bone-resorbing activity and for its survival (22). The interaction of RankL with receptor activator of NF-B (Rank), an integral receptor protein located on the surface of osteoclast precursors, triggers a number of signaling cascades that include the IKK/IK␤/NF-B transduction pathway and the mitogen-activated protein kinase (MAPK), Src, and phosphatidylinositol 3-kinase (PI3K)/AKT pathways as well (64). A novel calcium oscillation pathway that involves ITAM coreceptors is also involved in the downstream effects of RankL (35). Importantly, stimulation of these pathways culminates in the activation of multiple transcription factors, including c-fos, NF-B, and NFATc1, all of which play strategic roles in the differentiation process at the genetic level (44, 61). Overall, the timely activation of these transcription factors initiates growth arrest and promotes osteoclast differentiation, fusion, activation, and survival (63). The evidence that supports the essentiality of both RankL and its receptor in osteoclast formation is most strongly supported by the skeletal phenotypes of both RankL-and Rank-null mice, neither of which are capable of producing osteoclasts in vivo and thus are phenotypically osteopetrotic (20,37).RankL is synthesized and expressed on the surface of regulatory cells in response to a myriad of both local and systemic factors, many of which are essential to physiologic bone turnover. These include the two hormo...