Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

we have identified that the human IgG2 subclass exists as an ensemble of distinct isoforms, designated IgG2-A, -B, and -A/B, which differ by the disulfide connectivity at the hinge region. In this report, we studied the structural and functional properties of the IgG2 disulfide isoforms and compared them to IgG1. Human monoclonal IgG1 and IgG2 antibodies were designed with identical antigen binding regions, specific to interleukin-1 cell surface receptor type 1. In vitro biological activity measurements showed an increased activity of the IgG1 relative to the IgG2 in blocking interleukin-1␤ ligand from binding to the receptor, suggesting that some of the IgG2 isoforms had lower activity. Under reduction-oxidation conditions, the IgG2 disulfide isoforms converted to IgG2-A when 1 M guanidine was used, whereas IgG2-B was enriched in the absence of guanidine. The relative potency of the antibodies in cell-based assays was: IgG1 > IgG2-A > IgG2 Ͼ Ͼ IgG2-B. This difference correlated with an increased hydrodynamic radius of IgG2-A relative to IgG2-B, as shown by biophysical characterization. The enrichment of disulfide isoforms and activity studies were extended to additional IgG2 monoclonal antibodies with various antigen targets. All IgG2 antibodies displayed the same disulfide conversion, but only a subset showed activity differences between IgG2-A and IgG2-B. Additionally, the distribution of isoforms was influenced by the light chain type, with IgG2 composed mostly of IgG2-A. Based on crystal structure analysis, we propose that IgG2 disulfide exchange is caused by the close proximity of several cysteine residues at the hinge and the reactivity of tandem cysteines within the hinge. Furthermore, the IgG2 isoforms were shown to interconvert in whole blood or a "bloodlike" environment, thereby suggesting that the in vivo activity of human IgG2 may be dependent on the distribution of isoforms.

In this work, we present studies of the covalent structure of human IgG2 molecules. Detailed analysis showed that recombinant human IgG2 monoclonal antibody could be partially resolved into structurally distinct forms caused by multiple disulfide bond structures. In addition to the presently accepted structure for the human IgG2 subclass, we also found major structures that differ from those documented in the current literature. These novel structural isoforms are defined by the light chain constant domain (C L ) and the heavy chain C H 1 domain covalently linked via disulfide bonds to the hinge region of the molecule. Our results demonstrate the presence of three main types of structures within the human IgG2 subclass, and we have named these structures IgG2-A, -B, and -A/B. IgG2-A is the known classic structure for the IgG2 subclass defined by structurally independent Fab domains and hinge region. IgG2-B is a structure defined by a symmetrical arrangement of a (C H 1-C Lhinge) 2 complex with both Fab regions covalently linked to the hinge. IgG2-A/B represents an intermediate form, defined by an asymmetrical arrangement involving one Fab arm covalently linked to the hinge through disulfide bonds. The newly discovered structural isoforms are present in native human IgG2 antibodies isolated from myeloma plasma and from normal serum. Furthermore, the isoforms are present in native human IgG2 with either or light chains, although the ratios differ between the light chain classes. These findings indicate that disulfide structural heterogeneity is a naturally occurring feature of antibodies belonging to the human IgG2 subclass.

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major components of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD. ␣-Synuclein fibrils similar to the Lewy body filaments can be formed in vitro, and we have shown recently that both PDlinked mutations accelerate their formation. This study addresses the mechanism of ␣-synuclein aggregation: we show that (i) it is a nucleation-dependent process that can be seeded by aggregated ␣-synuclein functioning as nuclei, (ii) this fibril growth follows first-order kinetics with respect to ␣-synuclein concentration, and (iii) mutant ␣-synuclein can seed the aggregation of wild type ␣-synuclein, which leads us to predict that the Lewy bodies of familial PD patients with ␣-synuclein mutations will contain both, the mutant and the wild type protein. Finally (iv), we show that wild type and mutant forms of ␣-synuclein do not differ in their critical concentrations. These results suggest that differences in aggregation kinetics of ␣-synucleins cannot be explained by differences in solubility but are due to different nucleation rates. Consequently, ␣-synuclein nucleation may be the rate-limiting step for the formation of Lewy body ␣-synuclein fibrils in Parkinson's disease.Parkinson's disease (PD) 1 is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. A pathological hallmark of PD are Lewy bodies (1-3), which also accumulate in dementia with Lewy bodies (4) and multiple system atrophy (5, 6), but not in a variety of other neurodegenerative disorders. The major filamentous component of Lewy bodies is ␣-synuclein (4, 7), a 140-amino acid protein (8). Lately, two dominant mutations in ␣-synuclein causing familial early onset PD have been described (9, 10), suggesting that Lewy bodies contribute mechanistically to the degeneration of neurons in PD. Very recent in vitro studies have shown that recombinant ␣-synuclein can indeed form Lewy body-like fibrils (11-15). Most importantly, both PD-linked ␣-synuclein mutations accelerate this aggregation process (11, 15), which immediately suggests that such in vitro studies may have relevance for PD pathogenesis. We therefore decided to address the kinetic mechanism of ␣-synuclein fibrillogenesis. We have shown before that in a complete aggregation time course ␣-synuclein aggregation is slow and displays a distinct lag phase (15). This might be indicative of a nucleation-dependent polymerization mechanism consisting of an initial lag phase (nucleation) followed by a growth phase (elongation) and a steady state phase in which the ordered aggregate and monomer are at equilibrium. In the lag phase a supersaturated protein solution remains stable while soluble pre-nucleus oligomers build up. Once nuclei are formed, the aggregates grow rapidly (elongation ph...

A host of diverse stress techniques was applied to a monoclonal antibody (IgG 2 ) to yield protein particles with varying attributes and morphologies. Aggregated solutions were evaluated for percent aggregation, particle counts, size distribution, morphology, changes in secondary and tertiary structure, surface hydrophobicity, metal content, and reversibility. Chemical modifications were also identified in a separate report (Luo, Q., Joubert, M. K., Stevenson, R., Narhi, L. O., and Wypych, J. (2011) J. Biol. Chem. 286, 25134 -25144). Aggregates were categorized into seven discrete classes, based on the traits described. Several additional molecules (from the IgG 1 and IgG 2 subtypes as well as intravenous IgG) were stressed and found to be defined with the same classification system. The mechanism of protein aggregation and the type of aggregate formed depends on the nature of the stress applied. Different IgG molecules appear to aggregate by a similar mechanism under the same applied stress. Aggregates created by harsh mechanical stress showed the largest number of subvisible particles, and the class generated by thermal stress displayed the largest number of visible particles. Most classes showed a disruption of the higher order structure, with the degree of disorder depending on the stress process. Particles in all classes (except thermal stress) were at least partially reversible upon dilution in pH 5 buffer. High copper content was detected in isolated metal-catalyzed aggregates, a stress previously shown to produce immunogenic aggregates. In conclusion, protein aggregates can be a very heterogeneous population, whose qualities are the result of the type of stress that was experienced.