Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major components of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD. ␣-Synuclein fibrils similar to the Lewy body filaments can be formed in vitro, and we have shown recently that both PDlinked mutations accelerate their formation. This study addresses the mechanism of ␣-synuclein aggregation: we show that (i) it is a nucleation-dependent process that can be seeded by aggregated ␣-synuclein functioning as nuclei, (ii) this fibril growth follows first-order kinetics with respect to ␣-synuclein concentration, and (iii) mutant ␣-synuclein can seed the aggregation of wild type ␣-synuclein, which leads us to predict that the Lewy bodies of familial PD patients with ␣-synuclein mutations will contain both, the mutant and the wild type protein. Finally (iv), we show that wild type and mutant forms of ␣-synuclein do not differ in their critical concentrations. These results suggest that differences in aggregation kinetics of ␣-synucleins cannot be explained by differences in solubility but are due to different nucleation rates. Consequently, ␣-synuclein nucleation may be the rate-limiting step for the formation of Lewy body ␣-synuclein fibrils in Parkinson's disease.Parkinson's disease (PD) 1 is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. A pathological hallmark of PD are Lewy bodies (1-3), which also accumulate in dementia with Lewy bodies (4) and multiple system atrophy (5, 6), but not in a variety of other neurodegenerative disorders. The major filamentous component of Lewy bodies is ␣-synuclein (4, 7), a 140-amino acid protein (8). Lately, two dominant mutations in ␣-synuclein causing familial early onset PD have been described (9, 10), suggesting that Lewy bodies contribute mechanistically to the degeneration of neurons in PD. Very recent in vitro studies have shown that recombinant ␣-synuclein can indeed form Lewy body-like fibrils (11-15). Most importantly, both PD-linked ␣-synuclein mutations accelerate this aggregation process (11, 15), which immediately suggests that such in vitro studies may have relevance for PD pathogenesis. We therefore decided to address the kinetic mechanism of ␣-synuclein fibrillogenesis. We have shown before that in a complete aggregation time course ␣-synuclein aggregation is slow and displays a distinct lag phase (15). This might be indicative of a nucleation-dependent polymerization mechanism consisting of an initial lag phase (nucleation) followed by a growth phase (elongation) and a steady state phase in which the ordered aggregate and monomer are at equilibrium. In the lag phase a supersaturated protein solution remains stable while soluble pre-nucleus oligomers build up. Once nuclei are formed, the aggregates grow rapidly (elongation ph...

Edited by Gianni Cesareni Keywords:Fibroblast growth factor-21 b-Klotho Fibroblast growth factor receptor Partial agonist a b s t r a c t Fibroblast growth factor-21 (FGF21) signaling requires the presence of b-Klotho, a co-receptor with a very short cytoplasmic domain. Here we show that FGF21 binds directly to b-Klotho through its Cterminus. Serial C-terminal truncations of FGF21 weakened or even abrogated its interaction with b-Klotho in a Biacore assay, and led to gradual loss of potency in a luciferase reporter assay but with little effect on maximal response. In contrast, serial N-terminal truncations of FGF21 had no impact on b-Klotho binding. Interestingly, several of them exhibited characteristics of partial agonists with minimal effects on potency. These data demonstrate that the C-terminus of FGF21 is critical for binding to b-Klotho and the N-terminus is critical for fibroblast growth factor receptor (FGFR) activation.

Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies. Recently, two point mutations in ␣-synuclein were found to be associated with familial PD, but as of yet no mutations have been described in the homologous genes ␤-and ␥-synuclein. ␣-Synuclein forms the major fibrillar component of Lewy bodies, but these do not stain for ␤-or ␥-synuclein. This result is very surprising, given the extent of sequence conservation and the high similarity in expression and subcellular localization, in particular between ␣-and ␤-synuclein. Here we compare in vitro fibrillogenesis of all three purified synucleins. We show that fresh solutions of ␣-, ␤-, and ␥-synuclein show the same natively unfolded structure. While over time ␣-synuclein forms the previously described fibrils, no fibrils could be detected for ␤-and ␥-synuclein under the same conditions. Most importantly, ␤-and ␥-synuclein could not be cross-seeded with ␣-synuclein fibrils. However, under conditions that drastically accelerate aggregation, ␥-synuclein can form fibrils with a lag phase roughly three times longer than ␣-synuclein. These results indicate that ␤-and ␥-synuclein are intrinsically less fibrillogenic than ␣-synuclein and cannot form mixed fibrils with ␣-synuclein, which may explain why they do not appear in the pathological hallmarks of PD, although they are closely related to ␣-synuclein and are also abundant in brain. Parkinson's disease (PD)1 is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also affects several other regions of the brain. Pathological hallmarks of PD are Lewy bodies and Lewy neurites (1-3), which also accumulate in dementia with Lewy bodies (4) but not in a variety of other neurodegenerative disorders. Recently, two dominant mutations in ␣-synuclein have been linked to familial early onset PD (5, 6). This has put ␣-synuclein at the center of investigations into the pathogenesis of PD.␣-Synuclein is closely related to two other proteins, ␤-and ␥-synuclein (Fig. 1A). With 78% similarity ␤-synuclein has been called an "almost carbon copy" of ␣-synuclein (7), and it was not trivial to generate antibodies that clearly distinguish both forms (8); ␥-synuclein shares 60% similarity at the amino acid level with ␣-synuclein (Fig. 1A). All three synucleins are highly expressed in the human brain and show a strikingly similar regional distribution. They are all expressed in the thalamus, substantia nigra, caudate nucleus, amygdala, and the hippocampus (9). Moreover, ␣-and ␤-synuclein even share the same subcellular distribution; they colocalize to presynaptic terminals in primary hippocampal neurons (10), and they show a virtually complete overlap in human and mouse brain sections as demonstrated by double-stained confocal microscopy (11). No ␣-or ␤-synuclein-specific synapses were identified (11). The high expression of ␤-and ␥-synuclein in the substantia nigra and their similarity to ␣-synuclein ...

The physiological role of Dickkopf-1 (Dkk1) during postnatal bone growth in rodents and in adult rodents was examined utilizing an antibody to Dkk1 (Dkk1-Ab) that blocked Dkk1 binding to both low density lipoprotein receptor-related protein 6 (LRP6) and Kremen2, thereby preventing the Wnt inhibitory activity of Dkk1. Treatment of growing mice and rats with Dkk1-Ab resulted in a significant increase in bone mineral density because of increased bone formation. In contrast, treatment of adult ovariectomized rats did not appreciably impact bone, an effect that was associated with decreased Dkk1 expression in the serum and bone of older rats. Finally, we showed that Dkk1 plays a prominent role in adult bone by mediating fracture healing in adult rodents. These data suggest that, whereas Dkk1 significantly regulates bone formation in younger animals, its role in older animals is limited to pathologies that lead to the induction of Dkk1 expression in bone and/or serum, such as traumatic injury. ß